ID: 1004679696

View in Genome Browser
Species Human (GRCh38)
Location 6:17881162-17881184
Sequence CAACTTATAAAACTCATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004679690_1004679696 14 Left 1004679690 6:17881125-17881147 CCACCTTCTCAGAATCCCACTCC 0: 1
1: 0
2: 4
3: 32
4: 395
Right 1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG 0: 1
1: 0
2: 1
3: 10
4: 148
1004679692_1004679696 -1 Left 1004679692 6:17881140-17881162 CCCACTCCTTCCTCTTAGTTTGC 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG 0: 1
1: 0
2: 1
3: 10
4: 148
1004679694_1004679696 -7 Left 1004679694 6:17881146-17881168 CCTTCCTCTTAGTTTGCAACTTA 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG 0: 1
1: 0
2: 1
3: 10
4: 148
1004679693_1004679696 -2 Left 1004679693 6:17881141-17881163 CCACTCCTTCCTCTTAGTTTGCA 0: 1
1: 0
2: 2
3: 24
4: 362
Right 1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG 0: 1
1: 0
2: 1
3: 10
4: 148
1004679691_1004679696 11 Left 1004679691 6:17881128-17881150 CCTTCTCAGAATCCCACTCCTTC 0: 1
1: 1
2: 1
3: 38
4: 316
Right 1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004679696 Original CRISPR CAACTTATAAAACTCATACC AGG Intronic
901849690 1:12007511-12007533 CAACCTCTAAAACTCCTACTAGG - Intronic
902140813 1:14352512-14352534 CTACTAATAAAACCCATACTTGG + Intergenic
905265176 1:36748192-36748214 AAACTTATAAAACTCAGACATGG + Intergenic
906584271 1:46962416-46962438 CAATTCAGAAAACTCATACTTGG - Intergenic
906840896 1:49138174-49138196 CAACTTATAAAAGTCTCACCTGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
909024791 1:70469395-70469417 CAACTTGGAAAACACATATCAGG + Intergenic
911380198 1:97105082-97105104 CAATTTAAATAACTCATATCAGG + Intronic
919955530 1:202411063-202411085 CCACTTATAAAACTGTTTCCAGG - Intronic
920664358 1:207950456-207950478 CAATTTATAGAACCAATACCAGG + Intergenic
923164600 1:231347662-231347684 GAACTGATAAAACTCATTCTAGG - Intronic
923482687 1:234398405-234398427 CAACTTAGTAAACTAAAACCAGG - Exonic
923903143 1:238351652-238351674 CAATTTATAAAACTCAGAATGGG - Intergenic
923954993 1:239006585-239006607 GAACTTATAAAGCTCAAACATGG - Intergenic
924201199 1:241660692-241660714 AAACTTAGAAAAATAATACCTGG - Intronic
1064331320 10:14396851-14396873 CAACTAATAAAACTGTGACCTGG - Intronic
1069080379 10:64082295-64082317 CACCTTATAAAACTCCTCCCAGG - Intergenic
1072604042 10:96963048-96963070 CAACTTAAAAAACTCAGTTCAGG + Intronic
1073657881 10:105437033-105437055 CAACTCAAAACACTCTTACCGGG + Intergenic
1074144787 10:110707944-110707966 CAACATATAATAATCATATCAGG - Intronic
1079528130 11:21415219-21415241 CAACTTATAAAAGAAAGACCAGG + Intronic
1080293251 11:30695531-30695553 CAACTTCTAAAACTCACACTGGG - Intergenic
1088338667 11:108738320-108738342 CAACTTAAAAAACTCTTAAGAGG - Intronic
1088693593 11:112347926-112347948 CAGCCTACAAATCTCATACCTGG - Intergenic
1090321753 11:125851034-125851056 CAACTTATAATAATCACATCAGG + Intergenic
1090756456 11:129795963-129795985 TAACACAGAAAACTCATACCAGG - Intergenic
1091592238 12:1850498-1850520 CAACTTATAAAACAGATAAAGGG - Intronic
1092781053 12:11987823-11987845 CAACTTATAAAAATAGTACAGGG + Intergenic
1095236925 12:39807814-39807836 CAACTTTTAATAATCGTACCAGG + Intronic
1096828325 12:54295899-54295921 CAACTGATAAACCTCTTATCTGG - Intronic
1098775166 12:74603740-74603762 CAGCTTGTAAAACTGATACGAGG + Intergenic
1099146362 12:79049713-79049735 CAATTCATAAAACTCATTCATGG - Intronic
1103178135 12:118882642-118882664 TAACTCATAAAACTCTTACAAGG - Intergenic
1105006353 12:132723308-132723330 CAACTTCAAAAACAAATACCAGG + Intergenic
1105363337 13:19741480-19741502 CAACTTATACAACTTGTAACAGG + Intronic
1106944301 13:34809613-34809635 GAACTTATAAACCAGATACCAGG - Intergenic
1107704506 13:43087018-43087040 CAAATAATAAAACTCATATTTGG - Intronic
1113157111 13:107335887-107335909 CAATTTATAAAACTAATAAAAGG - Intronic
1115749467 14:36474651-36474673 GAACTTATAAAACATCTACCTGG + Intronic
1116911629 14:50472545-50472567 TAAAATATAAAACTCATACTGGG + Intronic
1121036308 14:90706462-90706484 CATCTTATAAAAATTATTCCAGG - Intronic
1121374641 14:93397233-93397255 CAACTGTTTAAATTCATACCTGG - Intronic
1123972115 15:25517000-25517022 CACCTTATAAAACACATACTTGG - Intergenic
1125234763 15:37500318-37500340 AAATTTATAAAACTCACACTCGG + Intergenic
1125241309 15:37580444-37580466 CAACTTCTAAAAGTCATGTCTGG + Intergenic
1125806879 15:42501043-42501065 ATACTTATAAAACTCAAGCCAGG + Intronic
1126248187 15:46536126-46536148 AAAATTATAAAACTCATAGAAGG - Intergenic
1127301255 15:57655967-57655989 CAAGTTACCAAACTCAAACCAGG - Intronic
1127443014 15:59030379-59030401 CCACTTAAAAATGTCATACCAGG + Intronic
1128688177 15:69702733-69702755 CAACTTTTAAGACTCAGTCCAGG + Intergenic
1130374513 15:83316720-83316742 CAACTTATAAAATTAGAACCTGG - Intergenic
1130748887 15:86688077-86688099 GAATTTATAAAACTAATGCCAGG + Intronic
1131358453 15:91767059-91767081 AAATTTATAATACTCATTCCTGG + Intergenic
1133291545 16:4725636-4725658 CAACTTATAAAACTCATGACTGG + Intronic
1134105131 16:11479933-11479955 CAATTTATAAAAAACATACGTGG - Intronic
1135093837 16:19546103-19546125 CAACTCATATAACTGATAGCTGG + Intronic
1135879975 16:26245919-26245941 AAAATTATAAAACTTATTCCTGG + Intergenic
1137648247 16:50094790-50094812 AAAATTTTAAAACTCTTACCTGG - Exonic
1137783984 16:51122418-51122440 GAACTTAAAAAAATCAAACCTGG - Intergenic
1138983020 16:62293812-62293834 TTACTTTTAAAACTCATACATGG + Intergenic
1141918494 16:87118532-87118554 CAACTTATAAAATTCTTACAAGG + Intronic
1142219193 16:88845014-88845036 AAAATTATAAAACCCATGCCTGG + Intronic
1144381100 17:14699085-14699107 CAACTTATAGAAGTCAACCCTGG + Intergenic
1150915572 17:69433302-69433324 GATCTTGTAAAACTCATGCCTGG + Intronic
1152972614 18:178309-178331 CAACTAATAAAATTCAGACCAGG - Intronic
1155514779 18:26613645-26613667 CAATTTATAAAGCTTATACTTGG - Intronic
1155841377 18:30647994-30648016 CAAATTTTAAAACTCATAAATGG + Intergenic
1156551242 18:38019678-38019700 CAACTGTAGAAACTCATACCAGG + Intergenic
1156565620 18:38185959-38185981 CAACATATAAAACTAATCACGGG + Intergenic
1160083790 18:75755001-75755023 CAAATTGTAGAACTCATACAGGG - Intergenic
1162710352 19:12589019-12589041 TAACTTAAAAAACTAATAACAGG + Intronic
1168160317 19:54506118-54506140 TAACTTTTAAAAATCAGACCAGG - Intronic
925935797 2:8758161-8758183 CAACTTATAAAAGCCATACAGGG - Intronic
927926960 2:27020221-27020243 CCACTTATCAAACTCATAAGGGG - Intronic
930229588 2:48829283-48829305 CAACTTAGAAAACACATGTCAGG + Intergenic
931642059 2:64390318-64390340 CAACTTATCAAAATCAAAACAGG - Intergenic
933162281 2:79038818-79038840 AAATTTATAAAACTCATTCAGGG - Intergenic
933209843 2:79553432-79553454 CAACACAGAAAATTCATACCAGG - Intronic
936093246 2:109514317-109514339 CACGTTATAAAACACAGACCAGG + Intergenic
942543857 2:177042563-177042585 CAACTTTTAAAATTCCTCCCTGG - Intergenic
943894182 2:193331917-193331939 TAACTTATAAACCTCACAGCTGG + Intergenic
944439610 2:199728596-199728618 TACTTTATAAAACTTATACCAGG + Intergenic
944921908 2:204423369-204423391 CAACTTAGAAAACACATTTCAGG + Intergenic
948115424 2:235491849-235491871 AAACTTATAAAACTCGTATAGGG + Intergenic
1170227204 20:14004316-14004338 CCACTTATAAAGCTCATATTGGG - Intronic
1178636766 21:34310549-34310571 CAATTCATGAAACTCAGACCTGG + Intergenic
1182365411 22:29775627-29775649 CACCTTATAAAAATAATACACGG - Intergenic
949582506 3:5403260-5403282 GAACTTAAAATAATCATACCGGG + Intergenic
950914112 3:16626294-16626316 CAATGTATAACACTCATATCAGG - Intronic
952057528 3:29466263-29466285 CAACTGACAAAGCACATACCTGG + Intronic
952131814 3:30372724-30372746 CAAATTATAGAACTGATATCTGG - Intergenic
954674023 3:52305820-52305842 CAACCTATAAACCACATGCCTGG - Intergenic
956771354 3:72528642-72528664 CTGCTTTTAAAACTCATAACAGG - Intergenic
957299109 3:78367874-78367896 TAAATTATAAAAATTATACCAGG + Intergenic
959269531 3:104189428-104189450 CAACTTATAATACACATAGGTGG + Intergenic
959287749 3:104438762-104438784 AAACTTTTAAAACTCATTTCCGG - Intergenic
960166957 3:114413363-114413385 CAACTTATAAAATTCATTAAAGG + Intronic
960490064 3:118306476-118306498 CAATATATAATAATCATACCAGG - Intergenic
961341767 3:126227897-126227919 CAACAAATATAACTCACACCTGG + Intergenic
963509344 3:146227555-146227577 CAAATTCTAGAACTCACACCAGG + Intronic
964249613 3:154697497-154697519 CATCTTATACATCTCATATCAGG - Intergenic
965805982 3:172542412-172542434 AAAGTTATAATACTCATACAAGG - Intergenic
971558060 4:28038643-28038665 ATAGTTATAAAACACATACCTGG + Intergenic
972422505 4:38902186-38902208 CAACTGAGAAAACTGAGACCTGG - Intronic
977478574 4:97543840-97543862 GAACTTATTAAACTCATAGATGG + Intronic
980675086 4:136067916-136067938 CAACCTATAAAACACATTCAAGG + Intergenic
982435285 4:155377781-155377803 CTAGTAATTAAACTCATACCTGG + Intergenic
986041116 5:3995026-3995048 CCACTTATAAAACTCCAGCCAGG + Intergenic
988656038 5:33212879-33212901 CCACAAATAAAACTAATACCAGG - Intergenic
992052015 5:72949829-72949851 CAACTTCTGAAACTCAGTCCTGG - Intergenic
993172782 5:84441206-84441228 CAATTGATAAAACTCTTGCCAGG + Intergenic
993211329 5:84956089-84956111 CAACTAATAAAACACATAAAAGG + Intergenic
995350138 5:111165380-111165402 CAACTGAGAAAACTCAAGCCAGG - Intergenic
996347684 5:122504770-122504792 CTACATATAAAACACTTACCTGG + Intergenic
996456044 5:123682704-123682726 ATACTTATAAAAATCTTACCTGG + Intergenic
996618328 5:125468905-125468927 CAACTCATAAAACACTTACTGGG - Intergenic
1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG + Intronic
1004811085 6:19263889-19263911 CTACTTATAAAAATGATACTAGG - Intergenic
1005058847 6:21757546-21757568 CAACTAAGAAAACTCAGACCTGG - Intergenic
1006478481 6:34273205-34273227 CAACTTATAAAACACTCTCCCGG - Intergenic
1007186439 6:39976173-39976195 CACCTTATCAAACTCAGATCTGG - Intergenic
1007271283 6:40639183-40639205 CTATTTCTAAAACTCATTCCAGG - Intergenic
1009920080 6:70046750-70046772 CAACTTGTTAAACTCATAGATGG + Intronic
1009989912 6:70829401-70829423 CAATTTAAAAAAATCATGCCAGG - Intronic
1010939490 6:81899117-81899139 GATCTTATAAAAATCATACATGG - Intergenic
1011933922 6:92751265-92751287 AAACTTAAAAAAATCATATCAGG - Intergenic
1012189571 6:96262685-96262707 CAAGTTATGAAACTACTACCAGG + Intergenic
1015054746 6:128886738-128886760 CATATTATAAAATTCAAACCTGG - Intronic
1015772660 6:136784934-136784956 CTACTTATAATACTCTTACTTGG + Intronic
1016382778 6:143501967-143501989 CTATTTATGAAACCCATACCTGG - Exonic
1017210144 6:151846855-151846877 CTGCTTATATAACTCATCCCAGG - Intronic
1019856576 7:3614452-3614474 AAAGTTATAAAACTCTGACCTGG - Intronic
1019892985 7:3961796-3961818 GTATTTATAAAACTCATGCCCGG - Intronic
1020829597 7:13077761-13077783 CTTCTTTTAAAACTCATACAGGG - Intergenic
1021963182 7:25892784-25892806 CAATTTTTAAATCTTATACCAGG + Intergenic
1024262866 7:47584712-47584734 CATCTTCTAAAACTCCTACAGGG - Intergenic
1027142972 7:75672780-75672802 AAACTTATAAAACTCATAGAGGG - Intronic
1028066351 7:86390064-86390086 CAAATTATAACAGTCATATCAGG - Intergenic
1028944223 7:96558435-96558457 CAGCTGATTAAACTCATCCCAGG - Intronic
1040080573 8:43280706-43280728 AAACTTAGAAAACTCATCTCTGG - Intergenic
1041865463 8:62568273-62568295 CAACTAATTAAACTCAGAGCTGG - Intronic
1045301773 8:100917417-100917439 CAATTTAAAAAAAACATACCAGG + Exonic
1051259664 9:15250894-15250916 CTAATTATAAAAGTAATACCAGG + Intronic
1052184121 9:25569350-25569372 CTACTCATAAACCTCATGCCTGG - Intergenic
1052242092 9:26285870-26285892 AAACTTAGAAAACTCATCACTGG - Intergenic
1052406126 9:28063596-28063618 CAAATCATATAACTCATACATGG + Intronic
1052972014 9:34382281-34382303 CAACTAAAAAAATTCAAACCCGG + Intronic
1055795069 9:79967276-79967298 GATCTTATAAAACTAATGCCAGG - Intergenic
1056203423 9:84298189-84298211 TAACTTAAAAAACTCAGGCCAGG + Intronic
1058442606 9:105023810-105023832 CAGCTTCTACAACTCAAACCAGG + Intergenic
1060651495 9:125331186-125331208 AAAATTATAAAACACATATCAGG - Intronic
1190764402 X:53464090-53464112 TAGCTTAGAAACCTCATACCTGG - Intergenic
1193398945 X:81019750-81019772 CAACTTTTAAAACCTATATCAGG - Intergenic
1193968788 X:88024303-88024325 AAACTGATAATACTCATTCCTGG + Intergenic
1194928454 X:99858045-99858067 AAACTAATAAAGCTCATTCCTGG - Intergenic
1195730941 X:107966521-107966543 TAACTGATAAAACTAAGACCTGG + Intergenic
1198301241 X:135335827-135335849 CAACTTTGAAATCTCACACCTGG + Intronic
1199385598 X:147218865-147218887 CAACTTGGAAAACACATACAAGG - Intergenic
1201563357 Y:15341787-15341809 CAACTTAGAAAACACATTTCAGG - Intergenic
1202579069 Y:26360111-26360133 CCACTTATAAAACTGTTTCCAGG + Intergenic