ID: 1004681990

View in Genome Browser
Species Human (GRCh38)
Location 6:17904915-17904937
Sequence GCCTCCTGGAAATTAGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004681988_1004681990 12 Left 1004681988 6:17904880-17904902 CCTAGATCTGAAAGATATACAGT 0: 1
1: 0
2: 3
3: 25
4: 270
Right 1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004681990 Original CRISPR GCCTCCTGGAAATTAGCCTA AGG Intronic
904565090 1:31424081-31424103 GCCCCCTGGACACTGGCCTAGGG + Intronic
906934964 1:50206661-50206683 GCCTTCTGGGAATTAACCTGGGG - Intergenic
907668860 1:56457037-56457059 GCCTCCAGGAAATTAGCTAGAGG - Intergenic
912975556 1:114326835-114326857 GCCTCATGGAAGTTCCCCTAAGG - Intergenic
915404726 1:155651050-155651072 GCCGCCTGAAAATTAGCTGATGG - Intergenic
916404685 1:164486369-164486391 GCCTCATGGATATTAGACTGTGG + Intergenic
921117295 1:212105348-212105370 CCCATCTTGAAATTAGCCTATGG + Intronic
921880969 1:220253588-220253610 CCCTCCTGGAATTTAGGCTTCGG - Intronic
923228914 1:231965374-231965396 CCCTCCTGGATATTTGGCTATGG - Intronic
1063766682 10:9149671-9149693 GCCTCCTGCAGATTGGCCTTTGG + Intergenic
1067454507 10:46408376-46408398 GAGTCCTGGAAATTAACCAAAGG - Intergenic
1067632695 10:47976263-47976285 GAGTCCTGGAAATTAACCAAAGG + Intergenic
1068601852 10:58965073-58965095 GCCATGTGGAAATAAGCCTAGGG - Intergenic
1068761019 10:60709358-60709380 ACCACATGGAGATTAGCCTAGGG + Intronic
1073273714 10:102289589-102289611 GCTTCCTAGGAAATAGCCTAAGG + Intronic
1076168589 10:128302051-128302073 GACTCCTGGATATTTGGCTAGGG + Intergenic
1076598503 10:131641317-131641339 GCTTTCTAGAAATGAGCCTAGGG - Intergenic
1078803757 11:14674515-14674537 ACCTCCTGGAATTTAGGCTTTGG + Intronic
1080735125 11:35006570-35006592 CACTCCTGGAAATGAGTCTAAGG + Intronic
1090065135 11:123497292-123497314 GCCTCCTGGAACTGAGAGTAGGG + Intergenic
1092728446 12:11507026-11507048 TCCTCCTGCAAATTAGCCCGAGG + Intergenic
1095397976 12:41782762-41782784 GCCTCCGGGAAGTGAGTCTAGGG + Intergenic
1095792124 12:46178762-46178784 GCATCCTGGAAATTTGGCCAGGG + Intergenic
1096258695 12:50077902-50077924 CTCTCCTGGAAATAAGCATAGGG - Intronic
1098489747 12:71061556-71061578 GTCTCCTGGACTTTAGCCTCAGG + Intronic
1100125064 12:91414776-91414798 GCCTATTTGAAATTATCCTAAGG + Intergenic
1104324013 12:127778714-127778736 TCCACCTGCAAATTAGACTAGGG + Intergenic
1110758691 13:79205955-79205977 TCATCCTGAAATTTAGCCTATGG + Intergenic
1112196398 13:97230710-97230732 GAATCCTGGAGATTAGGCTATGG - Intronic
1112865994 13:103898795-103898817 GCCTCCTGGAAATGAGGGAAGGG - Intergenic
1114846580 14:26330331-26330353 GCCTCCTGGAAATTTCCATGTGG - Intergenic
1118778733 14:68991687-68991709 GCCTCCTTGTAATTTGCCTCCGG - Intergenic
1127881286 15:63160495-63160517 TCCTCCAGGAATTTATCCTAAGG - Intergenic
1129862447 15:78873036-78873058 CCCTCCTGGAATTTAGGCTTCGG - Exonic
1131596402 15:93802656-93802678 CCCTCCTGGAAATTAACCCCAGG - Intergenic
1141922907 16:87147917-87147939 GCGTTCTGGAAATTAACCAAAGG + Intronic
1143576957 17:7799310-7799332 GCCTTCTGGAAATTAGTGTCAGG + Intronic
1146180580 17:30695728-30695750 ACTTCCTGGAAAATAGCCCAGGG - Intergenic
1147220050 17:38923226-38923248 GCCTCCTGGAAATGGGCCAATGG + Intergenic
1147491626 17:40873172-40873194 GAATCTTGGAAATGAGCCTAGGG + Intergenic
1148682712 17:49483890-49483912 GCCTCCTGGAGATCAGGCGACGG - Intergenic
1148724268 17:49777299-49777321 GCCTCATGGAAACTAGGCTTGGG - Intronic
1149585061 17:57780868-57780890 GCCTCCTGAAAATTTTCCTCTGG + Intergenic
1149607485 17:57935503-57935525 GCCTCCAGGAAATATGCCTGGGG + Intronic
1150415203 17:64982089-64982111 GCCTCTAGGAAGTTGGCCTATGG - Intergenic
1151048797 17:70952561-70952583 CCCTTCTGGAAATTGGCTTAGGG + Intergenic
1151173427 17:72267609-72267631 GCCTCCTGGAAGTGAATCTATGG + Intergenic
1151369800 17:73640559-73640581 GCCTCCTGGTAATTAGCGAAAGG + Intronic
1155445837 18:25912267-25912289 GGCTTCTGGAAATTGTCCTAAGG - Intergenic
1157106208 18:44776940-44776962 ACCTCCTGGGAGGTAGCCTAAGG - Intronic
1158746942 18:60211825-60211847 GCCTCCAAAAAAGTAGCCTATGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1162978008 19:14219812-14219834 ACTTCCTGGAAAGTAGCCCAGGG + Intergenic
926910540 2:17848771-17848793 GCCTCATGCAAATGAGCCTGGGG - Intergenic
927598894 2:24422987-24423009 ACCTACTGGAAATTGGCCCAGGG - Intergenic
928884293 2:36130485-36130507 GCCTTCTGGAAAGAAGCCCATGG + Intergenic
932886437 2:75553341-75553363 GCCTACTGTAAACTGGCCTATGG - Intronic
941930133 2:170930164-170930186 GCGTCCTGGAAGTTAAGCTAGGG - Intronic
945026969 2:205629099-205629121 GCAGCCTGGAAAATATCCTAAGG - Intergenic
1175141918 20:56867180-56867202 GCATGATGGAAATTAGCCTCCGG - Intergenic
1178008643 21:28255740-28255762 ATGTCCTGGAAAGTAGCCTATGG + Intergenic
1179448560 21:41451888-41451910 GCCTACAGGAAATGAGCCTGGGG + Intronic
1183068417 22:35379666-35379688 ACTTCCTGGAATTCAGCCTAGGG - Intergenic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1184379816 22:44138274-44138296 TCCTCCTGGAAATTCCCTTAGGG - Intronic
1184540949 22:45124295-45124317 GCTTCCTGAAAAACAGCCTATGG + Intergenic
1185223405 22:49640203-49640225 GCCTCCTGGAAGCTAGGCTGGGG - Intronic
949755434 3:7404647-7404669 GCTCCCTGGAATTTAGCATAGGG + Intronic
949988051 3:9554567-9554589 CCCTGCTGGAAAATAGCCTTTGG + Intergenic
951550139 3:23869075-23869097 GCTTCTTGGAACTTACCCTAAGG - Intronic
955487533 3:59449664-59449686 GCCTGCTGGAAATTGTCTTAAGG - Intergenic
956733307 3:72216537-72216559 GCCTCCTTCACATTACCCTATGG - Intergenic
957798230 3:85039952-85039974 GTCTTATGGAAATCAGCCTAAGG - Intronic
958945054 3:100353456-100353478 GCCTCCTGCACATTAGGCTTGGG + Intronic
960096924 3:113697666-113697688 ACCTTCTGGAAGTTAGCCCACGG - Intergenic
964052321 3:152410573-152410595 GCCTCCTTGAATGGAGCCTAAGG + Intronic
972204212 4:36752211-36752233 GGTTCAAGGAAATTAGCCTATGG - Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
975163828 4:71154200-71154222 TCTTCCTGGAAATGAGCTTATGG + Intergenic
979091614 4:116490147-116490169 GGCTCCTGGAAATTATGCAAGGG + Intergenic
979671616 4:123365748-123365770 GCCTCCTGGAAATCATCCAAAGG + Intergenic
983948857 4:173616866-173616888 CCCTCCTGGAATTTAGGCTTCGG + Intergenic
984066310 4:175052366-175052388 GCCTTTTGGTAACTAGCCTAAGG - Intergenic
985264752 4:188147262-188147284 GCCTCTTGGAAAGAAGCCTGCGG - Exonic
986101248 5:4613730-4613752 GCCTCCTTGTACTGAGCCTAGGG - Intergenic
987604822 5:20119624-20119646 GCTTACTGTAAATTAACCTAGGG - Intronic
990717834 5:58658502-58658524 GCCTACTGGAAATTATGCCATGG + Intronic
993639517 5:90384729-90384751 ATCTCTTGGAATTTAGCCTATGG - Intergenic
999296824 5:150464921-150464943 GGCTCCTGCAAATCAGCCTTGGG - Intergenic
1001974744 5:175988301-175988323 GGCTGCTGGAGATTTGCCTATGG + Intronic
1002242690 5:177855477-177855499 GGCTGCTGGAGATTTGCCTATGG - Intergenic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1009698362 6:67141071-67141093 GTCTCATGCAAATTAGACTAAGG + Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1012655513 6:101814161-101814183 TACTCCTGGAAATTTTCCTATGG - Intronic
1012930060 6:105307327-105307349 GCCTCCTGGAAAGGAGCTTTGGG - Intronic
1013433055 6:110072930-110072952 GCATTCTGGACATTAGCCTTGGG + Intergenic
1014723000 6:124940754-124940776 GCCTCTTGGAAATTGGTCTTTGG + Intergenic
1026336118 7:69395379-69395401 TCTTCCTGAAAATTAGCCCAGGG + Intergenic
1029249350 7:99224926-99224948 GCCACCTGAAAATTAACCTGAGG + Intergenic
1031725001 7:125227606-125227628 AACTCCTGGAAAATAGCATAGGG - Intergenic
1031754577 7:125622103-125622125 GCATGCTTGAAATTAGACTAAGG + Intergenic
1033068611 7:138180590-138180612 GTCTCCTGAAAAATAGCCGATGG + Intergenic
1043228110 8:77759874-77759896 GCAGCCTGGAAATTAACCAAAGG - Intergenic
1043792871 8:84495248-84495270 ATCACCTGGAAATTAGCATATGG + Intronic
1044866947 8:96580780-96580802 GCCTTCTGTAAAGTAGCCAATGG - Intronic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1047245579 8:123140499-123140521 GCATTCTGGAAATTAACCAAAGG - Intronic
1050420591 9:5460397-5460419 TCCTCCTGGAAATGACTCTAGGG + Intronic
1056719000 9:89057587-89057609 GCCTCCAGGTACATAGCCTAGGG + Intronic
1187398691 X:18940445-18940467 GGCTCCTGGAAGTTAGGCTTTGG + Intronic
1194816828 X:98452389-98452411 GCCTTGTGGAAATATGCCTAGGG - Intergenic
1195781508 X:108470716-108470738 CCATCCTGGACATTAGCCTTGGG - Intronic
1196347536 X:114681985-114682007 TCCTCCTGGAAATTAAAATAAGG - Intronic
1196791222 X:119467145-119467167 GCCTGCTGGCATTTTGCCTATGG + Intergenic