ID: 1004681990

View in Genome Browser
Species Human (GRCh38)
Location 6:17904915-17904937
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004681988_1004681990 12 Left 1004681988 6:17904880-17904902 CCTAGATCTGAAAGATATACAGT 0: 1
1: 0
2: 3
3: 25
4: 270
Right 1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type