ID: 1004681990 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:17904915-17904937 |
Sequence | GCCTCCTGGAAATTAGCCTA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 115 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 111} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1004681988_1004681990 | 12 | Left | 1004681988 | 6:17904880-17904902 | CCTAGATCTGAAAGATATACAGT | 0: 1 1: 0 2: 3 3: 25 4: 270 |
||
Right | 1004681990 | 6:17904915-17904937 | GCCTCCTGGAAATTAGCCTAAGG | 0: 1 1: 0 2: 0 3: 3 4: 111 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1004681990 | Original CRISPR | GCCTCCTGGAAATTAGCCTA AGG | Intronic | ||