ID: 1004684594

View in Genome Browser
Species Human (GRCh38)
Location 6:17930628-17930650
Sequence GGGAAGGTTATGGCAAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004684594_1004684604 27 Left 1004684594 6:17930628-17930650 CCACACTTTGCCATAACCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1004684604 6:17930678-17930700 AAGTTTCCACAATAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 97
1004684594_1004684599 -5 Left 1004684594 6:17930628-17930650 CCACACTTTGCCATAACCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1004684599 6:17930646-17930668 TTCCCTGGGACAGAAAATCCAGG 0: 1
1: 0
2: 1
3: 32
4: 386
1004684594_1004684605 28 Left 1004684594 6:17930628-17930650 CCACACTTTGCCATAACCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1004684605 6:17930679-17930701 AGTTTCCACAATAGACCACAGGG 0: 1
1: 0
2: 2
3: 45
4: 237
1004684594_1004684600 -4 Left 1004684594 6:17930628-17930650 CCACACTTTGCCATAACCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1004684600 6:17930647-17930669 TCCCTGGGACAGAAAATCCAGGG 0: 1
1: 0
2: 0
3: 50
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004684594 Original CRISPR GGGAAGGTTATGGCAAAGTG TGG (reversed) Intronic
900230702 1:1555653-1555675 GGCAAGCTTGTGGCATAGTGTGG - Intronic
900473598 1:2866120-2866142 GGGATGGTTCTGGCCGAGTGGGG + Intergenic
902372883 1:16016726-16016748 GAGATGGTGATGGCAGAGTGAGG - Intronic
903845686 1:26278810-26278832 TGGAAGGGTATGGAAAACTGAGG - Intronic
904814342 1:33183658-33183680 GGGAAGCCTATGGCAGAGAGGGG + Intergenic
907531417 1:55101695-55101717 GGGAAGGTACTGGAAAAGAGAGG + Exonic
907632970 1:56102882-56102904 GGGAAGGGTAGGGAAAAGGGGGG - Intergenic
908118910 1:60967215-60967237 GGGAAGGGTCTAGCAAAATGGGG + Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909520378 1:76561213-76561235 GGGAGGGTTGTGGGGAAGTGGGG + Intronic
913096144 1:115517479-115517501 GGGAAAGATATGGGAAAGTGTGG - Intergenic
913198662 1:116478254-116478276 GGGAAGGACAGGGCAAAGTGGGG + Intergenic
914156329 1:145092037-145092059 GTGAAGGGTAAAGCAAAGTGTGG - Intronic
914912452 1:151798896-151798918 TGGAAGGTTATGGAAAGGAGCGG + Intergenic
914913652 1:151805173-151805195 GAGAATGTTATGGAAAAGGGCGG + Intronic
915513359 1:156399317-156399339 GGGATGGTTACGGGAAAGAGAGG - Intergenic
915571135 1:156745645-156745667 GAGAAGGTGATGGCAAAGTCAGG - Intronic
915718332 1:157965092-157965114 TGGAAGGTTATGGGCAAGTCAGG + Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
918513957 1:185341976-185341998 GGACAAGTTATGGGAAAGTGAGG + Intergenic
920338819 1:205262603-205262625 GGAAAGGTTATTTCAAAGTTTGG - Intronic
921418058 1:214913467-214913489 GGGATGGCTGTGGCAAGGTGTGG + Intergenic
922138223 1:222853735-222853757 GGGAAGGGTAGGGGAAAGGGAGG + Intergenic
922787112 1:228288402-228288424 GGGAAGGGCATGGCACAGTCAGG - Intronic
923835018 1:237601426-237601448 GGGAAGGGTAGGTGAAAGTGGGG + Intronic
923972935 1:239226128-239226150 GTGGAGGCTATGGTAAAGTGGGG + Intergenic
1063355859 10:5397824-5397846 GGTGAAGTTAGGGCAAAGTGAGG - Intronic
1064757353 10:18583257-18583279 GGGTAGGTAATGGCAAATTACGG - Intronic
1065723417 10:28647658-28647680 GGGAAGGATAGGGGAAAGAGAGG - Intergenic
1067167023 10:43873576-43873598 GGGAAGGTTCTGGCAAGGCAAGG - Intergenic
1068917125 10:62444563-62444585 GGGCAGGTTAAGGAAAAGTTAGG - Intronic
1068922329 10:62497810-62497832 AGGAAGGTTTTGGCTAAGTAAGG + Intronic
1069157026 10:65042290-65042312 GGGATGGTGGTGGGAAAGTGAGG - Intergenic
1070423202 10:76258605-76258627 GGGAAGGGTAAAGCAAAGAGAGG - Intronic
1072337599 10:94412672-94412694 AGGAAGGTTTTGGGAAAGAGTGG + Intronic
1073883056 10:108006324-108006346 GGGACGCTTATGGCAAACTCAGG + Intergenic
1079447825 11:20572490-20572512 GGGAAGGTAATGGAAAATTACGG - Intergenic
1079986421 11:27205050-27205072 GGGAAGGTCTTGGCAAATTATGG - Intergenic
1080546299 11:33322287-33322309 GGGAATGTAATGGCCAGGTGTGG - Intronic
1081525287 11:43924077-43924099 GGGAAGGAAAGGGGAAAGTGGGG + Intergenic
1084971899 11:72776697-72776719 GGGAAGGTCAGGGCCACGTGTGG - Intronic
1085331655 11:75657080-75657102 AGGAAGCTTTTGGCAATGTGTGG + Intronic
1085596897 11:77819724-77819746 GGGAAGGGATTGGAAAAGTGGGG + Intronic
1086126318 11:83352243-83352265 GGAAATGTTATGGCCAGGTGCGG + Intergenic
1088132039 11:106504401-106504423 GGAAAGGTTTTGATAAAGTGTGG + Intergenic
1088834456 11:113566311-113566333 GAGGAGGCTAAGGCAAAGTGGGG + Intergenic
1090150222 11:124376303-124376325 GGTGAGGTTAAGGCACAGTGAGG - Intergenic
1095147883 12:38752421-38752443 GGGAAGGTTCTGGGAAGCTGAGG - Intronic
1096165874 12:49423493-49423515 GAGCAGGTTGTGGAAAAGTGGGG - Intronic
1096263407 12:50106493-50106515 GGGAAAGAGATGGCTAAGTGGGG - Intronic
1096611337 12:52803975-52803997 CAGAAGGTTATAGCAAAGAGGGG - Intergenic
1097557014 12:61150915-61150937 TGGCGTGTTATGGCAAAGTGGGG - Intergenic
1099205194 12:79718948-79718970 GGAAAGATCATGGCAATGTGAGG + Intergenic
1100426950 12:94496498-94496520 GGCAAGCTTATGGGAAAGTGAGG - Intergenic
1101989969 12:109476821-109476843 GGGCAGGTTATGAGAAGGTGAGG - Intronic
1103449076 12:121015395-121015417 GAGAAGGCTATGGCAAAGCAAGG - Intronic
1103598735 12:122040707-122040729 GGGAAGGTCAGGGAAAGGTGTGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104450568 12:128865169-128865191 GGGAAGGTTATGTCACTGAGGGG - Intronic
1108125541 13:47238847-47238869 GGGCAGGGTTTGGCAAACTGTGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108490627 13:50977653-50977675 GGCAAGGTGAGGGCAAAGTCAGG + Intergenic
1111175160 13:84584906-84584928 GGGGAGGTTCTGCCCAAGTGGGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117644595 14:57838210-57838232 GGGCAGGTTTTGGAAAAGCGAGG + Intronic
1118643190 14:67812413-67812435 GGGAAGCTTTTGGCAAAAGGTGG + Intronic
1119483908 14:74976102-74976124 GGGAAGGTTCAGGCCAAGTTTGG - Intergenic
1119541237 14:75439431-75439453 GGCATGGTAATGGCTAAGTGGGG + Intronic
1122647441 14:103204625-103204647 GGGCAGGTTGTGGGACAGTGGGG - Intergenic
1124075480 15:26440044-26440066 GGGAAGGGTATGGGGAAGGGTGG - Intergenic
1125499791 15:40232484-40232506 GAGGAGTTAATGGCAAAGTGAGG - Intergenic
1126484436 15:49164409-49164431 TGGATGGTTATGACAAGGTGAGG + Intronic
1127136714 15:55931906-55931928 GGGAAGGTTGAGGGAAAATGGGG - Intronic
1128624140 15:69182098-69182120 GGGAAGGTGATGGAAGATTGAGG + Intronic
1129122139 15:73405491-73405513 GGGAAGGTTGGGGGAAAGTGGGG - Intergenic
1129724161 15:77893245-77893267 GGGAAGGTGATAGCTCAGTGTGG + Intergenic
1134036284 16:11033614-11033636 GGTAAGGATCTGGAAAAGTGAGG - Intronic
1136619419 16:31418245-31418267 AGGAAGGGCATGGCAGAGTGAGG - Intronic
1138474804 16:57264283-57264305 GGGAAGGGTATGGCCCAGTGGGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139309154 16:66013667-66013689 GGGGAGGTGATGGTAAAGGGAGG - Intergenic
1141072261 16:80968495-80968517 GGGGAGGGCATGGCAAAGAGAGG - Exonic
1143389400 17:6551411-6551433 GGGAAGGTTATGGTCAAATATGG - Intronic
1143764137 17:9126651-9126673 GGGAAGGTTCTGGAAAAATTAGG + Intronic
1143802103 17:9391755-9391777 GGGAAGCATATGGCAGAGTAGGG + Intronic
1143954313 17:10656887-10656909 GGGAAGGTGAGGGCAGAGTGAGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147168434 17:38605234-38605256 GGGAAGGGGATGGAGAAGTGAGG - Intronic
1147344453 17:39779739-39779761 GGGCAGGTGAGGGCAAACTGTGG - Intronic
1147845904 17:43403740-43403762 GGAAAGGGCATGGGAAAGTGGGG - Intergenic
1148647348 17:49226581-49226603 GGAAAGGTGATGGGAAACTGGGG + Intronic
1151056491 17:71037780-71037802 GGGAGTATTATGGCAAAATGGGG + Intergenic
1151351457 17:73534467-73534489 GGGAAGGTTCAGGGACAGTGTGG + Intronic
1151405629 17:73884342-73884364 GGCAGAGTGATGGCAAAGTGGGG + Intergenic
1151568422 17:74913419-74913441 GGGCAGGTTACGCCATAGTGAGG + Intergenic
1151960554 17:77403262-77403284 GGGATGGTTGTGGCAGAGGGAGG + Intronic
1153132960 18:1878444-1878466 GGGAAGGTGATGGAAAAGTGAGG + Intergenic
1153208601 18:2733463-2733485 AGGAAGGTTATCTGAAAGTGAGG + Intronic
1153594311 18:6709081-6709103 GGGAGAGTTATGGCACAGGGTGG - Intergenic
1157599695 18:48886317-48886339 GGGAAGGAGATGGCAAAGTCTGG + Intergenic
1158001209 18:52621383-52621405 AGGTAGGCTATGGCAAAGTTTGG + Intronic
1158455102 18:57599273-57599295 GGGGAGGTTGTTGCACAGTGAGG - Intergenic
1160276981 18:77446021-77446043 GGGAAGGTCATGGCTAAGACTGG + Intergenic
1163830202 19:19543914-19543936 GTGAAGGTGGTGGCAGAGTGTGG + Exonic
1163933637 19:20422466-20422488 GGGAAGGGAATGGCAAATGGAGG - Intergenic
1166297388 19:41895755-41895777 GGGAAGGTTCTGGAAAAGGAAGG - Intronic
1166907799 19:46125424-46125446 GGGAAGGGCAGGGCAAACTGAGG + Intergenic
1166940309 19:46359151-46359173 GGGAAGGAGATGGCTCAGTGAGG + Intronic
1168503351 19:56912311-56912333 GGGTAGGGAATGGCAAAGGGTGG - Intergenic
925301662 2:2819164-2819186 TGGAAGGTTCTGCCAAAGTTTGG - Intergenic
926026463 2:9549502-9549524 GAGAAGGTTCTGGAAACGTGTGG + Intronic
926355936 2:12040767-12040789 GGAAAGGTTCTGCCCAAGTGAGG + Intergenic
927236270 2:20878529-20878551 GGAAAGGTAATGGCAGGGTGAGG + Intergenic
927292509 2:21419175-21419197 GAGAAGTTTAGGGCAAAGAGAGG + Intergenic
927673589 2:25089066-25089088 GGGAAGGATATAGCAAGGGGTGG + Intronic
927836377 2:26402230-26402252 GGGAAGGTTCAGGCAGAGTATGG + Intronic
928097934 2:28416316-28416338 GAGAGGGTTATGGGAAAGGGAGG + Exonic
928402592 2:30990080-30990102 GGGATGTCTATGGCAAGGTGGGG + Intronic
928766164 2:34648565-34648587 TGAAAGGTTAGGGCAAAGTATGG - Intergenic
929890038 2:45911268-45911290 GGGAAGGTTGTGCAACAGTGGGG - Intronic
931050254 2:58406150-58406172 GAAAAGGTAATGGCAAATTGTGG + Intergenic
931274710 2:60734257-60734279 GAGATGGATATGGCAAAGTACGG + Intergenic
931483630 2:62668731-62668753 TGTAAGGTTATGGCCAGGTGTGG + Intergenic
933273422 2:80258481-80258503 GTGAGGGGCATGGCAAAGTGTGG + Intronic
933673980 2:85036950-85036972 GGCAAGGTTGTGGAAAACTGAGG - Intronic
933676611 2:85063184-85063206 GGGCAGTTTCTGGAAAAGTGTGG - Intergenic
934771306 2:96909332-96909354 GGGCAGGTTTTGGCAAAATATGG - Intronic
937071342 2:119066050-119066072 GGGATGTTTCTGGCACAGTGAGG - Intergenic
937268176 2:120630283-120630305 GGGAAGGGGGTGGCAGAGTGGGG + Intergenic
938399273 2:130975548-130975570 GGGAAAGGCAAGGCAAAGTGGGG - Intronic
939016437 2:136909302-136909324 GGGAAGATTTTGGAAAAATGAGG + Intronic
941688404 2:168471178-168471200 GAGTAGGTTCTGGCAAAGAGGGG - Intronic
943862647 2:192888623-192888645 GGGGAGGTGGTGGGAAAGTGAGG + Intergenic
944310262 2:198225236-198225258 GTGAAGATTATGGCACAGTGTGG - Intronic
944415466 2:199475428-199475450 GGGAAGGGTATGGTGAAGAGAGG + Intergenic
945598181 2:211822141-211822163 GGGAAGGGTAGGGGAAAGAGAGG + Intronic
946010476 2:216560091-216560113 GGGAAGGTGATGGGGAAGAGAGG - Intronic
1169609278 20:7361159-7361181 GGTAAGGTGAGGGCAGAGTGTGG + Intergenic
1172768946 20:37366520-37366542 GGGAAGTTTAGGGGGAAGTGGGG - Intronic
1173061289 20:39664061-39664083 GGGGAGGGGATGGGAAAGTGAGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178070526 21:28960898-28960920 GGGAAGGTAACAGCAAAGCGTGG - Intronic
1178968390 21:37146691-37146713 TGGAAGGTTAGGGGAAAATGAGG + Intronic
1180023345 21:45143342-45143364 GGGAAGATTATGGCAAGGCAAGG - Intronic
1180717037 22:17878824-17878846 AGGTAGGTGATGGCAAAATGGGG - Intronic
1182572449 22:31249176-31249198 GGGCAGGTTTTGCCAAACTGTGG + Intronic
1183414785 22:37675996-37676018 GGGAAGGGTGTGGCCAACTGGGG + Intronic
950445340 3:13034233-13034255 GGGAAGATCATGGCAACCTGAGG - Intronic
951383438 3:22014291-22014313 GGGAAGTTTAAGGCAAAGGAAGG + Intronic
952676711 3:36040613-36040635 GGGAAGCTTGTGGGGAAGTGAGG - Intergenic
955263899 3:57423065-57423087 GGGACTGCTATGGAAAAGTGGGG + Intronic
955563053 3:60213645-60213667 GGAGATGTTATGGTAAAGTGTGG - Intronic
964761572 3:160139215-160139237 TGGAAGCTTTTGGCAAAATGAGG - Intergenic
964865864 3:161260112-161260134 GGGAAGGTTTGGGGGAAGTGGGG - Intergenic
965456258 3:168904455-168904477 GCAAAGGTTCTGGCAAAGTGTGG + Intergenic
965856118 3:173089780-173089802 GGGAAGGTGCTGGTAAACTGCGG + Intronic
966775837 3:183541996-183542018 GGGAAGGGTAGGGGGAAGTGAGG - Intronic
967992443 3:195141580-195141602 GGCAAGTTTATGCCAAAATGAGG + Intronic
969591835 4:8126494-8126516 GTGAAGGTGATGGCAAAATCTGG - Intronic
971254199 4:24999408-24999430 GGAAGGGGAATGGCAAAGTGGGG - Exonic
971963026 4:33514053-33514075 GTGAATGTTATTCCAAAGTGAGG + Intergenic
977216685 4:94293392-94293414 GGGAAGGTAATGGAAAATTACGG + Intergenic
977659977 4:99573830-99573852 GGGAATGTTTTGGCAAAGAAGGG - Intronic
979514250 4:121588692-121588714 GGGAAGCTTATTGCTTAGTGTGG + Intergenic
981274639 4:142884256-142884278 GTGAAGGTAATGGGAATGTGGGG - Intergenic
981388723 4:144162230-144162252 GGGAAGTTTATGGCCGGGTGCGG - Intergenic
981803948 4:148691186-148691208 GGGCAGGGTATGGAACAGTGTGG - Intergenic
982157824 4:152538736-152538758 GGGAAGGTCATGGCAGGGAGGGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986859106 5:11904900-11904922 GGGAAGGTGATGGCAAGATTGGG - Intergenic
988787982 5:34581547-34581569 GGGAAGGGTATAGCATAATGGGG - Intergenic
988865569 5:35330876-35330898 GGTCTGGTTATTGCAAAGTGGGG + Intergenic
991007189 5:61840950-61840972 GGCAAGGCTATGGGAAAGGGAGG - Intergenic
991077092 5:62553105-62553127 GGAAAGGTAAGGGGAAAGTGAGG - Intronic
992200673 5:74380883-74380905 GGCAAGTTGGTGGCAAAGTGGGG - Intergenic
993743105 5:91563650-91563672 GGGTAGGTTATGTCAGAGGGAGG - Intergenic
994166564 5:96615375-96615397 GAGATGGTTATGGCAGAGTAAGG - Intronic
997589998 5:135066688-135066710 GGGAATGGAGTGGCAAAGTGTGG + Intronic
997741207 5:136256520-136256542 GGTAAGGATATGACACAGTGAGG - Intronic
998635452 5:143949702-143949724 TGGGAGGTAATGGCAAAGTGGGG - Intergenic
998856667 5:146400791-146400813 GGGAAGGATGGGGCAAAGTAAGG - Intergenic
999383098 5:151135416-151135438 GGGATTGTTATGGCAATGAGAGG + Intronic
1000209861 5:159099108-159099130 GGGAAAGTGCTGGCAAAGCGTGG + Intronic
1000762225 5:165240560-165240582 GGGAAGATGATTGTAAAGTGGGG + Intergenic
1001343552 5:170869234-170869256 GGAAAGATTATGGAAAAGTCTGG - Intronic
1001820112 5:174703756-174703778 GGCAATGTTAAGGCAAAGTAAGG - Intergenic
1003592149 6:7445496-7445518 GGGAAGCTTGTGAGAAAGTGGGG + Intergenic
1003969876 6:11289057-11289079 GGTTAGTTTATGGCAAAGTCTGG - Intronic
1004257131 6:14074927-14074949 GTGAAGTTTATGACACAGTGGGG - Intergenic
1004684594 6:17930628-17930650 GGGAAGGTTATGGCAAAGTGTGG - Intronic
1004893709 6:20126522-20126544 GAGAAGGTTCTGGCAAGCTGTGG + Exonic
1006275391 6:33001304-33001326 GGGAAGGTTCTCCCAAACTGAGG + Intergenic
1007180605 6:39926744-39926766 GGGAAGGGGAGGGGAAAGTGGGG + Intronic
1007381157 6:41491179-41491201 GGGAAGGCTACGCCACAGTGGGG + Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1015465274 6:133542272-133542294 GGGAAGTTTAAGGCTCAGTGAGG - Intergenic
1015691098 6:135924408-135924430 GGGCAGGTTATGGCATTCTGGGG - Intronic
1015903582 6:138092893-138092915 GGGAAGGGCATGGGGAAGTGTGG + Intronic
1015921229 6:138268352-138268374 TGGACGTTTATGACAAAGTGAGG - Intronic
1016720413 6:147289756-147289778 GGGGAGGATATGGCAAAATACGG + Intronic
1020036057 7:4963717-4963739 GGGAGGGTTTTGGCCAGGTGAGG - Intergenic
1024564095 7:50667255-50667277 TGGAAGGTAATGGGATAGTGAGG - Intronic
1024714601 7:52061873-52061895 GGGGAGGTGGTGGGAAAGTGAGG - Intergenic
1026334806 7:69384484-69384506 AGGAAGGTTTTGGGAAGGTGGGG - Intergenic
1027425546 7:78058350-78058372 GGGAAGGGCACGGAAAAGTGGGG - Intronic
1027474603 7:78613712-78613734 ATGAAGGTTATGGCAAAGACAGG + Intronic
1028947935 7:96601861-96601883 GTGAAGGTTATGAAAAATTGTGG + Intronic
1029268671 7:99362700-99362722 GGGAAGGGGATGGCAAACTATGG - Intronic
1031541001 7:122994419-122994441 GGGAAGGTTAAAGTAATGTGTGG + Intergenic
1032553674 7:132809328-132809350 GGTAAGGATATGGGAAACTGAGG - Intronic
1032925541 7:136599849-136599871 TTGAAGCTTATGGCAAACTGAGG + Intergenic
1033929100 7:146501995-146502017 CGGAAGGATAGGGCAAAGAGAGG - Intronic
1035177649 7:157063498-157063520 GTAAAAGTTATGGCCAAGTGTGG + Intergenic
1036593064 8:10186207-10186229 GAGAAGAGGATGGCAAAGTGAGG - Intronic
1038196550 8:25373383-25373405 GGGAAGGTTATAGGAGGGTGAGG - Intronic
1039465637 8:37783392-37783414 GGGAAGGTTCTGGAGGAGTGAGG + Intergenic
1039684070 8:39777531-39777553 GGGAAGGGTAGTACAAAGTGGGG + Intronic
1040535496 8:48305551-48305573 GGGGAGCTGGTGGCAAAGTGGGG + Intergenic
1041386432 8:57309316-57309338 GGGAAGGATGTGGAAAAATGGGG + Intergenic
1044058987 8:87609982-87610004 GATAAGGTTATGGGAAAGTAGGG + Intronic
1044728541 8:95212470-95212492 GAGAAGGTGATGGGACAGTGAGG + Intergenic
1044886042 8:96778774-96778796 TGGCATGTTATGGCAAAGTGTGG + Intronic
1047529910 8:125665223-125665245 GGGGGGGCTATGGTAAAGTGGGG - Intergenic
1049259496 8:141631210-141631232 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049259505 8:141631255-141631277 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049259542 8:141631458-141631480 GGAAAGGTTCTGGAAAAGCGTGG + Intergenic
1049259590 8:141631728-141631750 GGAAAGGTTCTGGAATAGTGTGG + Intergenic
1049259612 8:141631840-141631862 GGAAAGGTTCTGGAATAGTGTGG + Intergenic
1049259708 8:141632314-141632336 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049259717 8:141632359-141632381 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049259740 8:141632472-141632494 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049259811 8:141632877-141632899 GGAAAGGTTCTGGAATAGTGTGG + Intergenic
1049259923 8:141633440-141633462 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049259955 8:141633598-141633620 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049260026 8:141634003-141634025 GGAAAGGTTCTGGAATAGTGTGG + Intergenic
1049260135 8:141634566-141634588 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049260167 8:141634724-141634746 GGAAAGGTTCTGGAACAGTGTGG + Intergenic
1049260187 8:141634837-141634859 GGAAAGGTTCTGGAAAAGCGTGG + Intergenic
1050827164 9:9961634-9961656 GGAAATGTTATGACAGAGTGTGG + Intronic
1053539942 9:38963168-38963190 GGCAATGTTATGGTAAAGTCAGG - Intergenic
1055528634 9:77160495-77160517 TGGATTGTTATGGCAAAATGAGG - Intergenic
1056881009 9:90393812-90393834 GGGAAGTTTAAGGCCAAGTCAGG - Intergenic
1059019334 9:110556777-110556799 GATAACGTTATGGCCAAGTGTGG - Intronic
1060534566 9:124374224-124374246 GGGAAGGTTGGGGGAAAATGGGG + Intronic
1061457161 9:130707181-130707203 GAGAAGGGAATGGCAAAGAGTGG + Intergenic
1186458730 X:9731437-9731459 TGGAAGATAATGGAAAAGTGCGG + Intronic
1186653895 X:11592172-11592194 GGGAAGTTGATGACACAGTGTGG + Intronic
1187126154 X:16456273-16456295 GGGAAGGTGAGTGCAAAGAGAGG + Intergenic
1187470208 X:19562965-19562987 GGGGAGATTACGTCAAAGTGGGG - Intronic
1188206099 X:27360144-27360166 GGGAGGGTTGTGGGGAAGTGGGG + Intergenic
1189147793 X:38673154-38673176 GGGAAGCTTAGGGCTAAGTATGG - Intronic
1191054588 X:56229009-56229031 GGGCAGAATAGGGCAAAGTGAGG - Intergenic
1192044435 X:67657270-67657292 GGTAAGGATAGGGGAAAGTGTGG - Intronic
1193455293 X:81724481-81724503 GGGAAGGATATGGAAGAATGGGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198488860 X:137117712-137117734 GGGAAGGTTAAGGTGAAGTGGGG + Intergenic