ID: 1004691294

View in Genome Browser
Species Human (GRCh38)
Location 6:17994409-17994431
Sequence CAATTTAAGCAGCTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004691293_1004691294 -4 Left 1004691293 6:17994390-17994412 CCGGTAAAAAGTAAAGAGACAAT No data
Right 1004691294 6:17994409-17994431 CAATTTAAGCAGCTTGCCCAAGG No data
1004691292_1004691294 12 Left 1004691292 6:17994374-17994396 CCTTCATTATAACTAACCGGTAA No data
Right 1004691294 6:17994409-17994431 CAATTTAAGCAGCTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004691294 Original CRISPR CAATTTAAGCAGCTTGCCCA AGG Intergenic
No off target data available for this crispr