ID: 1004700215

View in Genome Browser
Species Human (GRCh38)
Location 6:18071739-18071761
Sequence TTATAGAAGCAGACTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004700215_1004700221 16 Left 1004700215 6:18071739-18071761 CCCACCCCAGTCTGCTTCTATAA No data
Right 1004700221 6:18071778-18071800 AATAATGAATAGACAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004700215 Original CRISPR TTATAGAAGCAGACTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr