ID: 1004700900

View in Genome Browser
Species Human (GRCh38)
Location 6:18078540-18078562
Sequence CTGTTTAAAGGGTGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004700888_1004700900 27 Left 1004700888 6:18078490-18078512 CCAGGTTTCTTAGAATACACCAA No data
Right 1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG No data
1004700894_1004700900 -7 Left 1004700894 6:18078524-18078546 CCTGGGGTTTTTTATACTGTTTA No data
Right 1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG No data
1004700892_1004700900 8 Left 1004700892 6:18078509-18078531 CCAAAAACCTCTTCTCCTGGGGT No data
Right 1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG No data
1004700893_1004700900 1 Left 1004700893 6:18078516-18078538 CCTCTTCTCCTGGGGTTTTTTAT No data
Right 1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004700900 Original CRISPR CTGTTTAAAGGGTGGGAAAT GGG Intergenic
No off target data available for this crispr