ID: 1004709389

View in Genome Browser
Species Human (GRCh38)
Location 6:18155491-18155513
Sequence CGCGCGCCGCGCGCACAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004709389_1004709401 26 Left 1004709389 6:18155491-18155513 CCGTCCTGTGCGCGCGGCGCGCG 0: 1
1: 0
2: 1
3: 12
4: 63
Right 1004709401 6:18155540-18155562 GGCGGCGCGCACCGCCTCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
1004709389_1004709397 8 Left 1004709389 6:18155491-18155513 CCGTCCTGTGCGCGCGGCGCGCG 0: 1
1: 0
2: 1
3: 12
4: 63
Right 1004709397 6:18155522-18155544 GAGGCGCCCGCAGTCCAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 216
1004709389_1004709396 5 Left 1004709389 6:18155491-18155513 CCGTCCTGTGCGCGCGGCGCGCG 0: 1
1: 0
2: 1
3: 12
4: 63
Right 1004709396 6:18155519-18155541 GGAGAGGCGCCCGCAGTCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 127
1004709389_1004709395 4 Left 1004709389 6:18155491-18155513 CCGTCCTGTGCGCGCGGCGCGCG 0: 1
1: 0
2: 1
3: 12
4: 63
Right 1004709395 6:18155518-18155540 CGGAGAGGCGCCCGCAGTCCAGG 0: 1
1: 0
2: 2
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004709389 Original CRISPR CGCGCGCCGCGCGCACAGGA CGG (reversed) Exonic
900513176 1:3069802-3069824 CGCCAGCCGGGCGCAGAGGAGGG + Intronic
900645229 1:3705987-3706009 CGTGCACTGCCCGCACAGGAGGG - Intronic
915572394 1:156751592-156751614 CGCGCGCCGCACGGACGGGGCGG + Intronic
920260583 1:204685426-204685448 CGCGCGCCGTCTGCACAGGCCGG + Intronic
922503098 1:226110782-226110804 CGCGCGGCGCGGGCGGAGGAAGG + Intergenic
1072189572 10:93068924-93068946 TGCGCTCCGCGCCCAGAGGAAGG + Intergenic
1074618438 10:115093332-115093354 CGAGCGCCGCGCGCCCAGGAGGG - Intergenic
1076372721 10:129965264-129965286 CGCGCGCCGCGCGCTCACCCGGG - Intergenic
1076792757 10:132785732-132785754 CGCCCGCCGCGCCCACGGGCCGG + Exonic
1082979537 11:59106985-59107007 AGCGCGCAGCGCGCGCAGGTGGG - Intergenic
1083607343 11:63986746-63986768 CCCGCCCCGGGCGCACACGATGG - Intronic
1093940791 12:25051719-25051741 CACGTGCCACGAGCACAGGAAGG - Intronic
1102676828 12:114665089-114665111 CCCGCGCGGCGGGCCCAGGAAGG - Intergenic
1105004222 12:132711009-132711031 CGCGCGCCCCCCGCCCAGGCCGG - Exonic
1105008252 12:132736604-132736626 AGGGCGACACGCGCACAGGACGG + Intronic
1110775663 13:79405851-79405873 CGCGGGCGGCGCGCGGAGGAGGG - Exonic
1126626095 15:50686893-50686915 TGCGCGCCGCGCGCACGCGCTGG + Intergenic
1132055335 15:98647734-98647756 CGCGGGCCCCGCGCCCCGGAAGG - Intergenic
1132978341 16:2721373-2721395 CGCGCCCCGCGCCCACCAGAGGG - Intergenic
1137926455 16:52546570-52546592 AGCGCGGGGCGCGCCCAGGATGG + Intronic
1138327964 16:56191311-56191333 CGCGCGCCGGGCCCCCGGGACGG - Intergenic
1146126607 17:30236081-30236103 GCCGCCCCGCGCCCACAGGACGG + Intergenic
1151837874 17:76595774-76595796 GGCGAGCCGCGCGCAGAGGAAGG - Intergenic
1160659441 19:291415-291437 CCCGCCCCGCGCGGAGAGGAGGG + Intronic
1160763596 19:797631-797653 CGCCCGCCACGCGGAGAGGAAGG - Intronic
1160861320 19:1238226-1238248 GGTGCGCCGCGTGCGCAGGAGGG + Intergenic
1160991850 19:1863356-1863378 GGCGCGCCGCGCGCACATCCAGG + Exonic
1161114483 19:2489077-2489099 CGCGCCCAGGGCGCACCGGAGGG - Intergenic
1161165561 19:2785480-2785502 GGGGCGGCGCGCGCACAGGGAGG - Exonic
1161438871 19:4279529-4279551 CGGGCGCCGCGCGCAAAGTTGGG - Exonic
1162145515 19:8610688-8610710 GCCGCCCCGCGCGCGCAGGAAGG + Intronic
1162776611 19:12983639-12983661 CGCGCGGCCCGCGCGCAGGGAGG - Intergenic
1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG + Intronic
928042330 2:27890747-27890769 CCCGCGGCGCGCGCGCAGGTCGG + Exonic
936141809 2:109947661-109947683 CGAGCGCCGCGCGCCCAGGCGGG + Intergenic
936178497 2:110245609-110245631 CGAGCGCCGCGCGCCCAGGCGGG + Intergenic
936202881 2:110423823-110423845 CGAGCGCCGCGCGCCCAGGCGGG - Exonic
936524931 2:113235823-113235845 CGCCCGCCTCTCCCACAGGAGGG + Intronic
938381175 2:130837300-130837322 AGTGCCCCGCGCGCCCAGGACGG - Intronic
938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG + Exonic
942947131 2:181683665-181683687 CCCGCGCCGCGCGCTCAGAGCGG - Intergenic
945251037 2:207767042-207767064 CGAGCGCCGCGCTCACAGGCAGG - Exonic
948140490 2:235669540-235669562 CGCGGGCCGCGCGCCCAGCCGGG - Intronic
948906804 2:240983561-240983583 CGCGCTCAGCTCGCACAGGTAGG + Intronic
1169405347 20:5317039-5317061 CCCGGGTCGCGCGCGCAGGAGGG + Intergenic
1170998680 20:21391744-21391766 AGCCGGCCGCACGCACAGGATGG + Intergenic
1176550436 21:8218682-8218704 CGCGCCCCGCGCGCGCGGGAGGG + Intergenic
1176569365 21:8401721-8401743 CGCGCCCCGCGCGCGCGGGAGGG + Intergenic
1176577278 21:8445952-8445974 CGCGCCCCGCGCGCGCGGGAGGG + Intergenic
1176816645 21:13609759-13609781 CGCGCCCCGCACGCACATGACGG + Intergenic
1178488464 21:33033245-33033267 CGCGCGGCGCGGGCGGAGGAAGG + Intergenic
1181831636 22:25564890-25564912 CGCGCGGCGCGCGCGCGGGGCGG + Exonic
1182094080 22:27614529-27614551 CGGGCGCCGCGCCCGCGGGATGG + Intergenic
1183578275 22:38706230-38706252 CGCGCTCCCCGCGGACAGGGCGG - Intronic
1185044768 22:48523381-48523403 CGCGAGCCGGCCACACAGGAGGG - Intronic
1203255332 22_KI270733v1_random:135021-135043 CGCGCCCCGCGCGCGCGGGAGGG + Intergenic
971405925 4:26320848-26320870 CTCGCGCCGCCCGCAGAGTAGGG - Intronic
972437193 4:39045189-39045211 CGCGCCCCGCGCGCTCCGGGAGG - Intronic
980941595 4:139280076-139280098 CCCGCGCCGCTCGGAAAGGACGG - Exonic
984714985 4:182917226-182917248 CCCGCGCCACGCGCTCGGGACGG + Intronic
994710559 5:103259299-103259321 CGCACGACGCGCGCACACGGGGG - Intronic
1002424492 5:179167237-179167259 CGCGCGGGGCGGGCAGAGGAAGG + Intronic
1004709389 6:18155491-18155513 CGCGCGCCGCGCGCACAGGACGG - Exonic
1012450524 6:99349407-99349429 CCCGCGCCGCCCGCATGGGAAGG + Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013792974 6:113857268-113857290 CGCGCGCCGCACACAAAGCAGGG - Intergenic
1019111985 6:169724140-169724162 AGCGCGCCGCCCGCGCGGGAGGG + Intronic
1019505299 7:1387471-1387493 CGTGCGCCCCTCGCGCAGGATGG + Intergenic
1034977940 7:155458774-155458796 CCCGCGCCGGGCGCACATGGCGG - Exonic
1041511598 8:58659648-58659670 CGGGCGCAGAGCGCACAGGCAGG + Intronic
1042903019 8:73746934-73746956 CGCGCGGCGCGAGCGCGGGAGGG - Exonic
1044821991 8:96161020-96161042 CCCGCGCCGCGCGCACCGCCCGG - Intergenic
1047951647 8:129940000-129940022 CGGGCGCGGCGTGCAGAGGAAGG + Intronic
1049508920 8:143018253-143018275 CACCCGCCGCGCGCACAGCAGGG + Intronic
1049726147 8:144147436-144147458 CGCCCGCCGCGCGTCCAGGCTGG - Intergenic
1062392773 9:136340574-136340596 CGGGCCCCTCGCGCACCGGAGGG + Intronic
1203471730 Un_GL000220v1:118158-118180 CGCGCCCCGCGCGCGCGGGAGGG + Intergenic