ID: 1004719339

View in Genome Browser
Species Human (GRCh38)
Location 6:18252876-18252898
Sequence TTTGCCTTGTTTGTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 457}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004719339 Original CRISPR TTTGCCTTGTTTGTTTCTGC TGG (reversed) Intronic
900353387 1:2247966-2247988 GTTGACTTGTTTGGCTCTGCTGG + Intronic
900702560 1:4057313-4057335 GCTGCTTTGTTTGTTTCTGCTGG - Intergenic
901899721 1:12349406-12349428 TTTGCCTTTTTTTTTTCTTTTGG + Intronic
905880795 1:41462584-41462606 TTTGCCTTTTTTTTTTTTTCTGG + Intergenic
906324783 1:44838598-44838620 TTTGACTTGTTTGTCTTTCCTGG - Intronic
907446395 1:54510687-54510709 TTTGTTTTGTTTGTTTTTGTGGG - Intergenic
908679875 1:66648669-66648691 TTTGCCCTGTTTCTTTGCGCTGG + Intronic
909198895 1:72663459-72663481 TTTGCTTTTTGTGTTTCTGGAGG + Intergenic
909431769 1:75596482-75596504 TTTTTCTGGTTTATTTCTGCAGG - Intronic
909929384 1:81478029-81478051 TTTGCATTGTTTATTTTTGGGGG + Intronic
910536077 1:88299196-88299218 TTTGCCCTGTATGTTTTTGTAGG + Intergenic
910560483 1:88584609-88584631 TTTTCCTTGTTTGTTTGTGCAGG + Intergenic
911022106 1:93399490-93399512 ATTGCCTTATTTGTTTTTGTGGG - Intergenic
916795394 1:168162330-168162352 TTTGCCTTGGTTCTTTCTTGTGG + Intergenic
917065092 1:171084185-171084207 TTTGCCTTGTTTGAGTTGGCTGG + Intergenic
917227456 1:172800090-172800112 TTGGGTTTGTTTGTTTCTCCCGG - Intergenic
917655057 1:177117764-177117786 TTTGCCTGGGCTGTTTCTTCAGG + Intronic
918388051 1:184030644-184030666 TTTTGCTTGTCTGTTTCTGGTGG - Intronic
920222916 1:204417193-204417215 TTTGCCTTGTTCGTCTCAGCTGG + Intergenic
920341136 1:205275905-205275927 TTGGCCTTGTATGTTCCTGTGGG - Intergenic
921898241 1:220423417-220423439 TCTGCATTTTTTTTTTCTGCTGG + Intergenic
922319893 1:224477493-224477515 TTTTGCTTGTTTGTTTATGCAGG - Intronic
922573894 1:226649821-226649843 TTTGTTTTGTTTGTTTTTGCTGG - Intronic
922740096 1:228009705-228009727 GTTTCCTGGTTTGTTTCTCCAGG - Intronic
923203506 1:231735371-231735393 TTTTTTTTGTTTGTTTCTGTTGG + Intronic
923440995 1:234020236-234020258 TTAGCATTTTTTGTTTCTGTTGG + Intronic
923520440 1:234731279-234731301 GGTGTCTTGTTTGTTTCTGGTGG - Intergenic
924605600 1:245532084-245532106 TTTGCTTTGTTTTTTTCTTAAGG - Intronic
924630378 1:245733411-245733433 TTTGCTTTGGTTGCTTATGCTGG - Intergenic
924670384 1:246118568-246118590 TGTGGCGTGTTCGTTTCTGCTGG + Intronic
924816156 1:247443729-247443751 TTTGCCTTGGCTCTTTCTGTCGG + Intronic
924945846 1:248846529-248846551 TTTGCCTAGGCTGTTGCTGCTGG + Intronic
1062941255 10:1423041-1423063 TTTGCCTTGTGCATTTCTCCTGG + Intronic
1063472594 10:6300135-6300157 GGTGCCTTGTTTGTCTCTTCGGG + Intergenic
1063685456 10:8233095-8233117 TGTAGCTTGTTTGTTTTTGCTGG + Intergenic
1063860517 10:10302707-10302729 TTTGGCTTTTGTGTTTTTGCAGG + Intergenic
1063895988 10:10682637-10682659 TTTGCATTTTTTTTTTCTTCTGG + Intergenic
1064941420 10:20739793-20739815 TTTATCTTGTATGTTTCTCCCGG + Intergenic
1067275550 10:44829875-44829897 ACTGCCTTGATTGTTTCAGCAGG + Intergenic
1067561603 10:47308516-47308538 TTTCTCTTCTTTGTTTCTGTTGG - Intronic
1067983003 10:51108484-51108506 TTTGTTTTGCTTGTTTTTGCTGG - Intronic
1069030017 10:63585937-63585959 TTTGCTTTATTTGTTTATCCTGG + Intronic
1069065117 10:63934357-63934379 TTTGCCTTAGTTTTTTCTTCTGG + Intergenic
1069660643 10:70121310-70121332 TTTGCCTGGTTTGTCCCGGCTGG - Intronic
1070062832 10:73001808-73001830 TTTGCCTTGTGGTTTTCTGCTGG + Intergenic
1070139529 10:73728518-73728540 TTTTCTTTCTTTGTTTCTTCTGG + Intergenic
1070304300 10:75229862-75229884 TTTGCTTTTTTTTTTTTTGCTGG + Intronic
1070437580 10:76408686-76408708 TTTCCCTTTTGTTTTTCTGCTGG + Intronic
1070473898 10:76813281-76813303 TTTTCCCTCTTTGTTCCTGCTGG + Intergenic
1070703364 10:78619230-78619252 TTTGGCATGTTTATTTCTCCTGG - Intergenic
1070886746 10:79906619-79906641 TTTTCTTTCTTTGTTTCTTCTGG - Intergenic
1071113318 10:82188421-82188443 TTTGCTTTGGTTGCTTATGCTGG - Intronic
1073385859 10:103128000-103128022 TTTTGTTTGTTTGTTTTTGCAGG - Intronic
1073773363 10:106759917-106759939 TATGCCTTGTTTTTTTTTGAGGG - Intronic
1073871410 10:107869104-107869126 TTTGCTTTCTATGTTTCTTCAGG - Intergenic
1074740390 10:116480567-116480589 TTTGTTTTGTTTGTTTTTGCTGG + Intergenic
1075452438 10:122560868-122560890 TTTGCCATGATTGGGTCTGCAGG - Intronic
1075962515 10:126581563-126581585 TTTGCCTTTCATCTTTCTGCAGG + Intronic
1076269101 10:129134926-129134948 TTTGCCTCGTTTATTCCAGCTGG + Intergenic
1077649072 11:3953260-3953282 TTTGGCTAGTTTGTTTCAGGAGG + Intronic
1078083410 11:8219667-8219689 CTTGCCTTGTTTGTCTGGGCTGG + Intergenic
1079012155 11:16837730-16837752 TCTGCCTTCTCTGTTTATGCTGG - Intronic
1079726314 11:23884333-23884355 TTTGGCCTGTTTATTGCTGCTGG + Intergenic
1079742754 11:24084469-24084491 TTTACCTTTATTGTTTCTGTGGG - Intergenic
1080175709 11:29360581-29360603 TTTGCCTTGCTTCTTTTGGCTGG + Intergenic
1081040328 11:38201867-38201889 CTTGCTTTGTCTGTTTCTGGTGG - Intergenic
1081824439 11:46034745-46034767 TATGACATGTTGGTTTCTGCAGG - Intronic
1082101830 11:48179178-48179200 TTGGCCATGTTTGTTGCTCCTGG + Intergenic
1082686010 11:56240815-56240837 TTTGCCTTGGTTCTTTCTTGTGG - Intergenic
1082717286 11:56629528-56629550 ACTGCCTTGTTTGTGTCAGCAGG + Intergenic
1083553974 11:63611111-63611133 TGTGTTTTGTTTTTTTCTGCAGG + Intronic
1084193551 11:67510067-67510089 TTTTCCTTTTTTTTTTCTGCTGG + Intergenic
1084221944 11:67687486-67687508 TTTGACCTATTTGTTTCTGAAGG + Intergenic
1085600539 11:77852330-77852352 TTTGGTTTATTTGTTTCTGTTGG + Intronic
1086040707 11:82474166-82474188 TTTGTCGTTTTTGTTTTTGCAGG + Intergenic
1086092108 11:83015205-83015227 CTAGTCTTGTTTGTTTCTACTGG - Intronic
1086526990 11:87739320-87739342 TTTTGTTTGTTTGTTTCTGAAGG - Intergenic
1086892347 11:92272550-92272572 TTTTGCTTGTTTCTTTCTACTGG - Intergenic
1086939899 11:92784672-92784694 TTTGCTTTGTTTGTTAGTTCGGG + Intronic
1087183896 11:95165514-95165536 TTTGCCTACTTTGTTTATACTGG - Intergenic
1087235149 11:95709789-95709811 ATTGTCTTATTTGTTTCTGGAGG + Intergenic
1087329959 11:96768567-96768589 TTTGCCTTGTTGCTTTCTCTAGG + Intergenic
1087832645 11:102836226-102836248 TTTCCCTTGTCTGTATTTGCAGG - Exonic
1088763442 11:112953620-112953642 TTTTGTTTGTTTGTTTCTTCAGG + Intergenic
1088980526 11:114858979-114859001 TTCTACTTGTTTGTTTCAGCTGG + Intergenic
1089769180 11:120790514-120790536 TTTGCCCTGTTTTTTTGTTCAGG - Intronic
1090214926 11:124953780-124953802 TTAGCTTAGTTTGTTTCTCCAGG + Intergenic
1090498552 11:127239135-127239157 TGTGCCTTTTTTTTTTCTCCTGG + Intergenic
1091054150 11:132402650-132402672 TTTGCCTAGTTTTGTTTTGCTGG + Intergenic
1091829865 12:3542081-3542103 ATTGCCATATTTGTTCCTGCTGG + Intronic
1091929855 12:4386887-4386909 TTTGGTTTCTCTGTTTCTGCTGG - Intergenic
1092564851 12:9653972-9653994 TTTTACTTGTGTTTTTCTGCTGG - Intergenic
1093050683 12:14501091-14501113 TTTGTTTGGTTTGTTTCTTCTGG + Intronic
1094602169 12:31918608-31918630 TTTTGTTTGTTTGTTTTTGCAGG - Intergenic
1095359701 12:41321632-41321654 TTTGCTTTGTTTGTTTGTTTTGG + Intronic
1096770520 12:53933447-53933469 TTTTACTTGTCTGTTTCTGAAGG + Intergenic
1097081029 12:56430968-56430990 TTGGACCTTTTTGTTTCTGCAGG - Exonic
1097117350 12:56707362-56707384 TTTGCCTTTTTTTTTTTTGGGGG + Intergenic
1098254406 12:68602033-68602055 TTTTCCTTATATATTTCTGCTGG - Intergenic
1098851763 12:75604452-75604474 TTTCACTTTCTTGTTTCTGCAGG - Intergenic
1099751128 12:86773509-86773531 TTTGGTTTGTTTGTTTGTGTTGG - Intronic
1099821820 12:87721292-87721314 TTTTTCTTGTTTGTCTCTCCAGG - Intergenic
1100212936 12:92417011-92417033 TTTGCCTTTTTTGTCTATCCAGG - Intergenic
1101281188 12:103257762-103257784 CTTGCTTTGTTTTTTTCTTCAGG - Intronic
1101680753 12:106962465-106962487 TGTGTTTTGTTTGTTTTTGCTGG + Intronic
1101761083 12:107659733-107659755 TTTCCCTTGGCTTTTTCTGCAGG - Intergenic
1102078206 12:110076679-110076701 TTTTGCTTGTTTGTTTGTGACGG + Intergenic
1102155251 12:110721134-110721156 TTTGGCTTCTTTTTCTCTGCAGG + Exonic
1102789197 12:115630055-115630077 TTTGCCCTGTATGTTTCTTTGGG - Intergenic
1103413475 12:120728901-120728923 CTTGCCTTGTCTGTCACTGCTGG + Intronic
1103735058 12:123055800-123055822 TCTGCCCTGTTTGCTTCTGCTGG - Intronic
1103738302 12:123074768-123074790 ATTGGCATGTTTGTGTCTGCAGG - Intronic
1104156888 12:126142203-126142225 TTTGCCTTGTCTGTTTTGGATGG - Intergenic
1104303021 12:127582871-127582893 TTTTGCTTGTTTGTTTTTGATGG + Intergenic
1105573927 13:21631964-21631986 TTGAAGTTGTTTGTTTCTGCTGG + Intergenic
1106080327 13:26495397-26495419 TTTCCCATGTTTTTTCCTGCAGG + Intergenic
1106497993 13:30298880-30298902 TTTGCCTTTCTTTTTTCTCCTGG - Intronic
1106681733 13:32015310-32015332 TCTGCCTTGTTGTTTTCTACGGG + Intergenic
1106699868 13:32217860-32217882 TTTGTTTTGTTTGTTTTTGGTGG + Intronic
1107656689 13:42598799-42598821 TTTTCTTTCTTTCTTTCTGCAGG - Intronic
1108768675 13:53667961-53667983 TTTTTCTAGCTTGTTTCTGCTGG + Intergenic
1108833292 13:54506393-54506415 TTTTGTTTGTTTGTTTCTTCCGG - Intergenic
1108886793 13:55195721-55195743 TTTGTTTTATTTCTTTCTGCAGG + Intergenic
1109993004 13:70083460-70083482 CTGGCCTTGTTTATTTCTGAAGG + Intronic
1110046025 13:70831772-70831794 TTTCTCTTGTGTGTTTATGCTGG - Intergenic
1110107970 13:71703511-71703533 TTGGTATTGTTTGTTGCTGCAGG + Intronic
1110520855 13:76474579-76474601 TTCTCCATCTTTGTTTCTGCTGG + Intergenic
1111075200 13:83226373-83226395 TTTGGTTTGGTTGTTGCTGCAGG - Intergenic
1111084807 13:83361577-83361599 TTTACCTTTTGTGTTTCTGAAGG - Intergenic
1111573728 13:90121688-90121710 TTTTCCTTGTTTTATTCTGCTGG + Intergenic
1111653537 13:91124069-91124091 TTTGCCTTGCTGGTTTCTTCTGG + Intergenic
1112829647 13:103433338-103433360 TTTGACTTTTCTGTTTCTACTGG + Intergenic
1113501609 13:110780272-110780294 GTTGCCATGTTTAATTCTGCAGG + Intergenic
1114841745 14:26271389-26271411 TTTACCTGGTTTATTTCTGAAGG - Intergenic
1115364386 14:32540851-32540873 TTTGCTTTGTTTTTTTTTTCAGG + Intronic
1115736483 14:36336703-36336725 TTTGCCTTTTTTCTTTGTGAGGG - Intergenic
1115795854 14:36934943-36934965 TTTTTCTTCTTTCTTTCTGCGGG - Intronic
1116406215 14:44569098-44569120 TTTTCTTTGTCTTTTTCTGCAGG - Intergenic
1116698651 14:48207897-48207919 TTTTTCATGTTTGTTTCTTCTGG + Intergenic
1116941149 14:50792166-50792188 GTTGCCATGGTTCTTTCTGCTGG - Intronic
1117108498 14:52423822-52423844 CTTCCCTTATTTTTTTCTGCTGG + Intergenic
1117526344 14:56610243-56610265 TTTGCTTTGTTTGTTTGAGATGG + Intronic
1119948983 14:78725131-78725153 TTCCCCCTCTTTGTTTCTGCAGG + Intronic
1120100528 14:80439682-80439704 TTTTCCTTGTTTGTTTGTTTAGG + Intergenic
1120329400 14:83070821-83070843 TTTTCCTTGTGTTTTTCTCCTGG + Intergenic
1120439812 14:84521678-84521700 TTTGCTTTATTTGTTTCTACAGG + Intergenic
1121118423 14:91359711-91359733 TTTTCCCCCTTTGTTTCTGCAGG - Exonic
1121261471 14:92569380-92569402 GTTTCATTTTTTGTTTCTGCTGG + Intronic
1122594211 14:102878306-102878328 TTTGCATTGTGTGTTTCTGTGGG + Intronic
1202937113 14_KI270725v1_random:99893-99915 TGTGCCTTGTTTCTTGCTTCTGG + Intergenic
1123784766 15:23659566-23659588 TTTTGTTTGTTTGTTTCTGCCGG - Intergenic
1123912295 15:24979925-24979947 TTTTCTTTGTTTGTTTTTGAAGG + Intergenic
1124576751 15:30916173-30916195 TTTACCTTTTTTGTTTTTACTGG + Intronic
1124986626 15:34623153-34623175 TTTCCCAGTTTTGTTTCTGCAGG - Intergenic
1125823936 15:42659528-42659550 TTTGTTTTGTTTGTTTGTGATGG + Intronic
1126440193 15:48679362-48679384 TTTGCTTTCTCTGTGTCTGCTGG - Intergenic
1128885080 15:71279379-71279401 GTTGCCATGTTTGTTTAAGCCGG + Intronic
1129480068 15:75816868-75816890 TTCCCTTTGTTTGTTTCTGCTGG + Intergenic
1129823347 15:78619357-78619379 TTTTCCTGGGTTGTTTCTGCCGG + Intronic
1129836361 15:78709756-78709778 TTGGCCTTGTTGGTTTAAGCTGG - Intronic
1130220444 15:82014917-82014939 TTTGCAGTGTTTTTTTCTCCAGG - Intergenic
1130754062 15:86744329-86744351 TTTGCCTTTATTGTTTGTCCCGG + Intronic
1131827333 15:96331847-96331869 TTTGTTTTGTTTGTTTCTCTCGG - Exonic
1132383148 15:101380443-101380465 TTTGCCTTCTCTGTCTTTGCTGG - Intronic
1132633216 16:929732-929754 TCTGCCGTCTGTGTTTCTGCTGG - Intronic
1133681033 16:8120015-8120037 TTTCCCTTGTTTTTTTTTTCAGG + Intergenic
1135186192 16:20317810-20317832 TTTCCCTTGTTTTTGTCAGCCGG + Intronic
1136427728 16:30180426-30180448 TTTGCCTCTCTTGTTCCTGCTGG - Intergenic
1137270853 16:46901499-46901521 TTTCCTCTGTTTATTTCTGCTGG + Intronic
1138712648 16:58986714-58986736 TCTGCCTTGCCTGTTGCTGCTGG + Intergenic
1139848476 16:69936567-69936589 TTTGCCTTGATGGTGGCTGCTGG + Intronic
1140491095 16:75336516-75336538 TATGCATTGTTTGTATGTGCAGG - Intronic
1142907098 17:3050972-3050994 TTTGCATTGTTTGTTTTTGCAGG + Intergenic
1144337881 17:14287964-14287986 TCTTCCTTGTATGTTTCTGTAGG + Intergenic
1144366792 17:14552414-14552436 TTGGCATTGTCTGTTTCTGAGGG + Intergenic
1146838986 17:36136393-36136415 TTTGCCTAGTCTCTTTCTGTGGG + Intergenic
1147327928 17:39678735-39678757 GTTGCCCTGTGAGTTTCTGCAGG - Intronic
1149153798 17:53601768-53601790 TTTTCCTTCTTTATTTCTGTAGG + Intergenic
1149161926 17:53704451-53704473 ATTCCCTTTTTTCTTTCTGCTGG - Intergenic
1149307493 17:55363185-55363207 TTTGCCTTTTGTGTTCCTGTTGG - Intergenic
1149679159 17:58492677-58492699 TAAGCCTTGTCTCTTTCTGCTGG - Intronic
1150073988 17:62176861-62176883 GTTTGCTTGTTTGTTTTTGCAGG - Intergenic
1150479098 17:65496075-65496097 GTTTGTTTGTTTGTTTCTGCTGG + Intergenic
1151080947 17:71327711-71327733 TTTGTCTTGATTGTTCCTGTTGG - Intergenic
1151488888 17:74420277-74420299 TTTGTCTTCTTTGCTCCTGCTGG - Intergenic
1151981265 17:77510644-77510666 TTTGCCTGCTTTGTTCCTCCAGG - Intergenic
1152063630 17:78097723-78097745 AGTGCCGTGTTTGGTTCTGCAGG + Exonic
1152369484 17:79877577-79877599 TCTGGCTTGTCTGTTTTTGCTGG + Intergenic
1153057547 18:961945-961967 TTTCCCTTGTTTCTTCCTTCAGG + Intergenic
1153522324 18:5964505-5964527 TTTGCCTTTTTTTTTTCTAAGGG + Intronic
1154984905 18:21540700-21540722 TTTGTTTTGTTTTTTTATGCAGG - Intronic
1155348687 18:24884524-24884546 ATTTGCCTGTTTGTTTCTGCTGG + Intergenic
1155496386 18:26447014-26447036 TTTGTCTTGTTTGTTTGTTTTGG - Intergenic
1156625772 18:38906262-38906284 TTTTCCTTCATTGCTTCTGCGGG - Intergenic
1156750601 18:40449544-40449566 TTTGCCTGGTCCATTTCTGCTGG - Intergenic
1156837376 18:41570431-41570453 TTTGATTTGTTTTTTTCTCCCGG + Intergenic
1157951755 18:52046313-52046335 TTTTGTTTGTTTGTTTCAGCCGG + Intergenic
1157984954 18:52426573-52426595 TTTGCCTTGTAGGTTTTTGTCGG - Intronic
1158465331 18:57685114-57685136 TTTGTCCTGTTTGTTTCTCAGGG - Exonic
1159410156 18:68062739-68062761 TTTACATTGTTTGTATGTGCTGG + Intergenic
1160414903 18:78702495-78702517 TTTGTTTTGTTTGTTTATTCTGG + Intergenic
1162224373 19:9207952-9207974 GTTGGCTTGATTGTTACTGCAGG - Intergenic
1162323007 19:9980859-9980881 TTTGCCTTTTTTTTTTGTTCAGG - Exonic
1164131636 19:22368525-22368547 TTTCCCTTTTTTCTTTGTGCCGG - Intergenic
1164478191 19:28591343-28591365 ATTGCTTTGTTTGTTCCTGGGGG - Intergenic
1166030292 19:40120191-40120213 TTTGACATCTTTGTATCTGCAGG - Intergenic
924968423 2:100442-100464 CTTGTCTTGTCTTTTTCTGCAGG - Intergenic
925651880 2:6099519-6099541 TTTCTCTTGTTTGATTCTTCTGG + Intergenic
927118941 2:19935603-19935625 TTTTCCTTTTTTCTTTCTGTAGG - Exonic
927714884 2:25345176-25345198 TTGGAGTTGTTTGTTACTGCAGG - Intergenic
930058758 2:47272023-47272045 TCTGCCCTGTTTACTTCTGCAGG - Intergenic
930300176 2:49605765-49605787 TCTGCCTTATTTGTGTCTTCTGG - Intergenic
931294125 2:60905097-60905119 TTTTCTTTGTTTGTTTGTGATGG + Intronic
932861221 2:75293599-75293621 TTTTCTTTCTTTCTTTCTGCTGG - Intergenic
934925013 2:98376224-98376246 ATTGCTTTGTGTGTTTCTGGTGG - Intronic
935935437 2:108177414-108177436 TTTTGCTTGTTTGTTTTTGCAGG + Intergenic
937075871 2:119106071-119106093 TTTACTTTGTTTGGTTCTGAGGG - Intergenic
937925675 2:127165789-127165811 TTTGCCTGGTTGGCTTCAGCTGG - Intergenic
939009463 2:136828728-136828750 CTTGCCTCGTTTGTTTCACCTGG + Intronic
939061122 2:137422306-137422328 TTTGTTTTGTTTGTTTTTGCAGG + Intronic
939355450 2:141095770-141095792 TTGGTCTTGCTTGTTTCAGCAGG + Intronic
939693001 2:145289125-145289147 TTTGGCTTGTTTTTATCTTCTGG - Intergenic
939827251 2:147029616-147029638 TTAGCATTGTTTGTTTCAGTAGG + Intergenic
941710959 2:168712794-168712816 TTTGCCTTGGTTGTTTTCTCTGG + Intronic
941931830 2:170948328-170948350 TTTGTCGTTTTTGTTTCCGCAGG + Exonic
942979983 2:182069143-182069165 CTTGGCTTTTTTGTTTGTGCTGG + Intronic
943104646 2:183529328-183529350 TTTCCCTTGTGTGTATGTGCAGG + Intergenic
943876165 2:193070959-193070981 TTTGCATTCTGTGTGTCTGCAGG - Intergenic
945660057 2:212674732-212674754 TTTGCATTGCTTGTTTTTGTTGG + Intergenic
946047699 2:216834890-216834912 CTTTCCTGGTTTGTTTCTGTTGG - Intergenic
946521625 2:220470812-220470834 TTTCACTTGTTTGTTTCTGATGG + Intergenic
946905452 2:224411818-224411840 TTTGTTTTGTTTGTTTCAGGAGG - Intergenic
947412813 2:229859350-229859372 TGTGGCTTATTTGTTTCTGAGGG + Exonic
948022631 2:234748629-234748651 ATTTGCTTGTTTGTTTCAGCAGG - Intergenic
948047947 2:234958003-234958025 TTGGCTTTGGTTGCTTCTGCTGG + Intronic
1169366249 20:4995203-4995225 ATTCCCTTGTTTGTTCCTGTAGG - Intronic
1169768376 20:9174137-9174159 TTTGTTTTGTTTTTTTCTCCTGG + Intronic
1171167721 20:22986646-22986668 TTGGTCTTGTTTCTTTCTGGAGG - Intergenic
1171723058 20:28584850-28584872 GTTGCTTTGTTTGTCTCTGTTGG - Intergenic
1171787662 20:29484291-29484313 CTTGCTTTGTTTGTCTCTGTTGG - Intergenic
1171790204 20:29515814-29515836 CTTGCTTTGTGTGTTTCAGCTGG + Intergenic
1171857512 20:30361028-30361050 CTTGCTTTGTGTGTTTCGGCTGG - Intergenic
1171860292 20:30395083-30395105 CTTGCTTTGTTTGTCTCTGTTGG + Intronic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1173042527 20:39477779-39477801 TTTGATGTGTTTGTTTCTGGAGG + Intergenic
1174545076 20:51319048-51319070 ATTGCTTTTTTTTTTTCTGCAGG + Intergenic
1174961497 20:55162243-55162265 TTTGACTTTTTAGTTGCTGCTGG + Intergenic
1175662976 20:60833294-60833316 GTTGGCTTATTTGTTTCTGTTGG - Intergenic
1175875047 20:62225443-62225465 TTTGCTTTCTCTCTTTCTGCAGG + Intergenic
1176586208 21:8589214-8589236 TGTGCCTTGTTTCTTGCTTCTGG - Intergenic
1177085564 21:16698708-16698730 TTAGGTCTGTTTGTTTCTGCAGG + Intergenic
1177129021 21:17233686-17233708 TTTGGCATGTATTTTTCTGCCGG + Intergenic
1177265403 21:18777076-18777098 TTTGCTTTGTTTCCTTTTGCTGG - Intergenic
1177276178 21:18915552-18915574 TTTGTTTTGTTTGTTTCCACTGG + Intergenic
1178178331 21:30130204-30130226 TTTGTTTTGTTTTTTTCTGCAGG - Intergenic
1179317539 21:40257766-40257788 TTACCCTTGTTTTTTTCTCCTGG + Intronic
1180261839 21:46675582-46675604 TCAGCCTTGTCTCTTTCTGCAGG + Intergenic
1180269014 22:10566118-10566140 TGTGCCTTGTTTCTTGCTTCTGG - Intergenic
1180296613 22:10943521-10943543 CTTGCTTTGTTTGTCTCTGTTGG - Intergenic
1180390910 22:12280935-12280957 CTTGCTTTGTGTGTTTCGGCTGG + Intergenic
1181990502 22:26833358-26833380 TTTGTTTTGTTTCTTTCTGTTGG + Intergenic
1182023236 22:27098472-27098494 TTTCCATTGATTGTCTCTGCAGG + Intergenic
1183491413 22:38118280-38118302 TTTGCCTTGTTTGAATCAGGTGG + Intronic
949561279 3:5205045-5205067 AGTGCCTTGTTTATTTTTGCAGG + Exonic
949616709 3:5761514-5761536 TTTGCCTTGCATCTTCCTGCAGG + Intergenic
950980183 3:17295517-17295539 TTTGGTTTGTTTGTACCTGCTGG - Intronic
951426946 3:22557394-22557416 TTTCCCTTATGTTTTTCTGCAGG - Intergenic
951602699 3:24394164-24394186 TTTTCCTTGCTTGTTTCTTGAGG + Intronic
952802596 3:37310033-37310055 TTTTGTTTGTTTGTTTTTGCTGG + Intronic
952943165 3:38458535-38458557 TTTGCCTTTTGTGATCCTGCCGG + Intronic
953238425 3:41126380-41126402 GTTGCCTTATTTGATTCTTCAGG + Intergenic
953363132 3:42318114-42318136 TTTGCTTTGTTTGCTTTTTCTGG + Intergenic
954482564 3:50814750-50814772 TTTTAGTTTTTTGTTTCTGCTGG + Intronic
955178664 3:56643806-56643828 TTTGCATACTTTGTTTCTGAAGG - Intronic
955557362 3:60152411-60152433 ATTGAGTTGTTTGTTTCTCCAGG + Intronic
956510113 3:69984343-69984365 TTTCCTTTGTTTGTTTTTGGAGG - Intergenic
957133433 3:76252806-76252828 TTTGCTTTGTTTTTTTTTGAAGG + Intronic
958103710 3:89047218-89047240 TTTTGTTTGTTTGTTTTTGCAGG + Intergenic
958620545 3:96552577-96552599 TGTCCCTTGTGTGTTACTGCTGG + Intergenic
958632150 3:96698874-96698896 TTTGAATTATTTGTTTCTCCAGG + Intergenic
958723805 3:97878403-97878425 TTTGCTTTGTTTGTTTGAGACGG - Intronic
958830684 3:99085133-99085155 TTTCCCTTTTTTTTTTCTTCTGG + Intergenic
958864354 3:99483779-99483801 TTTGACTTTTTAGTTTCAGCTGG + Intergenic
960240339 3:115333532-115333554 TTTTGCTTGTTTGTTTTTGTAGG + Intergenic
961424759 3:126836299-126836321 TTTGCATTGGTTTTTTCAGCAGG + Intronic
961869175 3:129975716-129975738 TGTGCGTGGTTTGTTTCTGGCGG + Intronic
962055344 3:131865652-131865674 TATGCCTTGTTTGTTGGTGGTGG - Intronic
964305863 3:155339004-155339026 TTTTCCTTCTTTGTATCTGGAGG + Intergenic
964629771 3:158797898-158797920 TTTACCTTTTTTTTTTCTGTAGG + Intronic
965099243 3:164275352-164275374 TTGGCCTGCTGTGTTTCTGCTGG - Intergenic
965213365 3:165825913-165825935 TTTGCTTTGTTTCTATCTGATGG - Intronic
966337395 3:178884004-178884026 TTTGGCATGTTTGTTTCTGCAGG + Intergenic
966489983 3:180516866-180516888 TTTGCCTAGTTTCATTCTGGTGG - Intergenic
966935769 3:184707890-184707912 TTAGCCTTATTTGTACCTGCTGG + Intergenic
967480255 3:189964380-189964402 TTTGCCTTCTTTGAATTTGCAGG - Intronic
969954577 4:10875328-10875350 TTAGCCTAGTTCATTTCTGCTGG + Intergenic
970005245 4:11404666-11404688 TTTACCTGGTTTGTTTCTTGAGG - Intronic
970254777 4:14155895-14155917 TTGGACTTGTTTCTTTCAGCAGG - Intergenic
970406771 4:15771422-15771444 TTTGCATTTTATCTTTCTGCAGG - Intergenic
970730107 4:19092492-19092514 TTTGCATATTTTGTTTCTTCTGG - Intergenic
970786813 4:19807275-19807297 TTTGTCATGTTTGTTTATGCAGG - Intergenic
971182246 4:24339741-24339763 TTTGCTTTGTTTTTTTCAGACGG + Intergenic
972095803 4:35345330-35345352 TCTGCCTGCTTTGTATCTGCTGG - Intergenic
973105511 4:46331485-46331507 TTTGTTTTGTTTGTTTATCCAGG + Intronic
973752993 4:54042521-54042543 TCTGGCTTGTTTGTTTGTGTTGG - Intronic
973769164 4:54190846-54190868 TGTGCCTTATTTGTTTCTGAAGG - Intronic
973794849 4:54414723-54414745 TTTTATTTGTTTTTTTCTGCTGG + Intergenic
974713658 4:65637251-65637273 TTTTTTTTGTTTGTTTCTGGAGG - Intronic
975188383 4:71430698-71430720 TTTTCCTCTTTTGATTCTGCTGG + Intronic
976089193 4:81438198-81438220 TTTGTTTTTTTTGTTTCTGTAGG - Intronic
976218514 4:82737016-82737038 TTTTCTTTCTTTGTTTCTCCAGG + Intronic
977432369 4:96946376-96946398 TTTTCCTGGTTTCTTTTTGCTGG - Intergenic
977859250 4:101936024-101936046 TTTGCTTTGTTTGTCTGTGCGGG - Intronic
977870975 4:102090438-102090460 TGGGCCATGTTTGTTTCTGTAGG + Intergenic
978039843 4:104046328-104046350 TTTGCCTTCTGAGTTTATGCTGG - Intergenic
980568163 4:134573132-134573154 TTTCTCTTGTCTGTTTCTCCTGG - Intergenic
980877735 4:138678897-138678919 TTTTGTTTGTTTGTTTCTGGTGG - Intergenic
982046007 4:151446479-151446501 TTTTCCTTTTTTTTTTTTGCAGG + Intronic
983159711 4:164397255-164397277 TTTGCCTTATTTTTAACTGCAGG - Intergenic
983980520 4:173990369-173990391 GTTTTCTTGTTTGTTTCTGGGGG - Intergenic
984604096 4:181764694-181764716 TTTGCTTTTTTTGTTTGTGATGG + Intergenic
985438455 4:189958918-189958940 CTTGCTTTGTTTGTCTCTGTTGG + Intronic
986342661 5:6804264-6804286 CCAGCCTTGTTTGTATCTGCAGG - Intergenic
986741578 5:10710093-10710115 TTTCCCTGTTTTGTTTCTGAAGG - Intronic
987707360 5:21473462-21473484 TTTGCCTGGTTTTTTAGTGCAGG - Intergenic
988954321 5:36299063-36299085 TTTGCCTGCTTTGTATTTGCTGG - Intronic
989676019 5:43973581-43973603 TTTATCTTGTTTGTTCCTTCTGG + Intergenic
989696738 5:44210639-44210661 TTTGTCTTGTTTGTTTGTTTTGG + Intergenic
990010967 5:50997112-50997134 TTTGACTTTTGTGTTACTGCTGG + Intergenic
990146848 5:52770655-52770677 TTTGCCATGTTATTTTCTGTTGG - Intergenic
990267085 5:54088546-54088568 TTTGCCTTGGTTGTTTCATCAGG - Intronic
990343403 5:54847862-54847884 TCTGCCTTGTTCGTTTCAGCAGG - Intergenic
990653534 5:57929269-57929291 CTTACTTTGGTTGTTTCTGCAGG - Intergenic
990942655 5:61218830-61218852 TTTGTGTTGTTTGTTTCTGCTGG + Intergenic
990999632 5:61769714-61769736 TTTCTTTTGTTTGTTTCTTCAGG - Intergenic
991054223 5:62305184-62305206 TTTGTTTTGTTTGTTTTTGAGGG - Intergenic
991263315 5:64689861-64689883 TTTGCCTTTTTTTTTTCCTCTGG + Intergenic
992371953 5:76152733-76152755 TTTGCCCTGTGGGTTTCTGCTGG + Intronic
993268802 5:85765827-85765849 TTTGCTTTGATTGTCTGTGCTGG + Intergenic
993810708 5:92472258-92472280 TGTGTCTTCTTTGTTTCTCCTGG + Intergenic
994079544 5:95691876-95691898 TTGGTTTTGTTTGTTTCTGCTGG + Intronic
994341498 5:98634581-98634603 TTACCCTTTTTTGTTTCTGTAGG - Intergenic
996030629 5:118700511-118700533 TTTGGTTTGCCTGTTTCTGCTGG + Intergenic
996118069 5:119640514-119640536 TTTTTCTCCTTTGTTTCTGCTGG + Intergenic
996872895 5:128211834-128211856 TTAGACTTGTCTGTTTCTCCTGG - Intergenic
997910620 5:137869249-137869271 TTTGCCTATTTTGTTTCATCTGG - Intronic
1000366346 5:160494749-160494771 TTTGCAAAGTTTGTTTATGCAGG - Intergenic
1002433184 5:179216042-179216064 GTTGCCTTTTTTGTTTTTGATGG - Intronic
1002602995 5:180364948-180364970 TTTGCTTTGTTTTGTTTTGCTGG + Intergenic
1002680723 5:180961299-180961321 TTTGCCATGTTTGTACCTTCTGG + Intergenic
1003330124 6:5122768-5122790 TCTGCCTCGTTTGTCTCTGTTGG - Intronic
1003419758 6:5946479-5946501 TTTGCCTTGTTTTTCTGTGGTGG - Intergenic
1004017722 6:11747394-11747416 TTTGTTTTGTTTGTTTGTGTAGG + Intronic
1004030663 6:11865903-11865925 TTCGCCTTGTTCATTTCAGCTGG - Intergenic
1004346761 6:14856248-14856270 CTTGCTGTGTTTGTTTCTGAGGG + Intergenic
1004719339 6:18252876-18252898 TTTGCCTTGTTTGTTTCTGCTGG - Intronic
1006344155 6:33466438-33466460 TTTGACTTCTGTGTATCTGCAGG - Intergenic
1006880982 6:37339529-37339551 TTTGTTTTGTTTGTTTTAGCAGG + Intergenic
1006975234 6:38094323-38094345 TTTGCTTTTTTTTTTTCTTCTGG - Intronic
1007411683 6:41666579-41666601 TTTTTCTTCTTTGTTTCTTCTGG - Intergenic
1007540418 6:42638034-42638056 TTTGTTTTGTTTTTTTCTGGAGG + Intronic
1008328390 6:50215204-50215226 TTTACCCTGTTTGTTTCTACAGG - Intergenic
1008932881 6:56958088-56958110 TTTGCCTTTGGTGTTTATGCCGG - Intronic
1009764607 6:68055853-68055875 TTTTTCTTGTTTGTGTCTTCAGG + Intergenic
1009970968 6:70625280-70625302 TTTGCTTTTGTTGTTTCTTCTGG - Intergenic
1010496712 6:76541665-76541687 TTTGTCTTGTTTCTTTCAACTGG - Intergenic
1011447517 6:87457789-87457811 TTTGCTTTGGTTGTCTGTGCTGG - Intronic
1012740549 6:103011329-103011351 TTTGCATTTTTTTTTTCTGAAGG + Intergenic
1013856872 6:114583257-114583279 TCTGCCTGCTTTGTATCTGCTGG + Intergenic
1013865369 6:114690160-114690182 TTTGGCATGTTTGTTTCTTCTGG + Intergenic
1013960586 6:115894509-115894531 TTTGCCTTTTTTTGTTCTGTTGG + Intergenic
1015093911 6:129391364-129391386 TTTGCCGTGAGTGTTCCTGCTGG - Intronic
1015332165 6:131992960-131992982 TTTTGCTTGTTTGTTTTAGCAGG - Intergenic
1015754277 6:136592022-136592044 TTTGCCTTCTTTTTTCCTGTGGG + Intronic
1015916232 6:138220016-138220038 TTTCCTTTCTTTTTTTCTGCAGG + Intronic
1016186876 6:141208078-141208100 TTTGTTTTGTTTTTTTCTGGTGG + Intergenic
1016383156 6:143506162-143506184 TTTGCCTTATTGTTTTCTCCAGG - Intronic
1017151278 6:151282596-151282618 TTTGCCCTTTTGGTTGCTGCGGG + Intronic
1017202325 6:151768870-151768892 TGTGCCTTGTGTTTTCCTGCTGG + Intronic
1018727560 6:166625996-166626018 TTTGGTTGGTTTGTTTCAGCTGG - Intronic
1018869346 6:167769342-167769364 TTTCCCTTCTTTTTTTCTTCAGG + Intergenic
1019339148 7:500293-500315 TTGGCCTTGATGGTGTCTGCTGG - Intronic
1020003509 7:4768981-4769003 TTTTCCTTGTATTTTTGTGCAGG + Exonic
1021271608 7:18594156-18594178 TGTGCATTGTTTGCTTATGCTGG - Intronic
1021503569 7:21356209-21356231 TTTGCCATGTATGTTTGTGCAGG - Intergenic
1021638675 7:22716886-22716908 TTTGCCTTTTTTTTTTTTGGTGG + Intergenic
1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG + Intronic
1022104294 7:27187492-27187514 TTTGCCTTGTTGGTCACTGCTGG - Intergenic
1022653342 7:32297116-32297138 TTTGCCTAGGCTGTTCCTGCAGG - Intronic
1022707213 7:32813881-32813903 CTTCCTTTGTTTGTTTCAGCAGG - Intergenic
1022915661 7:34948752-34948774 CTTCCTTTGTTTGTTTCAGCAGG + Intronic
1023702924 7:42910921-42910943 TTTGCCTTGTTTCTTTCCCTAGG - Exonic
1023945632 7:44800774-44800796 TTTGTTTTGTTTGTTTTTGGGGG + Intronic
1023989341 7:45118890-45118912 TCTGCCTTGTATGTATATGCTGG - Intergenic
1024525612 7:50346545-50346567 TTTGCCTTGCTTTTTCTTGCTGG + Intronic
1024995728 7:55271979-55272001 TTGGCCTGTTTTGTTTATGCAGG - Intergenic
1027003395 7:74670988-74671010 TTTTCCTTGTTTGTTTTTTAAGG + Intronic
1028199062 7:87939090-87939112 TTTGCCTTGTGATTTTCTGGAGG + Intronic
1028665528 7:93339125-93339147 TTCTCCTTTTTTTTTTCTGCTGG + Intronic
1029190682 7:98769919-98769941 TTTTCTTTGTTTGTTTGTGAGGG + Intergenic
1029603779 7:101585941-101585963 TTTGTCTTGTTTGGTTTTGTAGG + Intergenic
1030828578 7:114191809-114191831 TTTGTGTTGTTTTTTTCCGCGGG + Intronic
1030840721 7:114350642-114350664 TTTGCCTTCTTAGTTGCTACTGG - Intronic
1031209312 7:118802240-118802262 TTTGCTTTGTTTGTTTTAGGGGG + Intergenic
1031807076 7:126319609-126319631 TTTGACTTTTTTCTTTATGCAGG + Intergenic
1031809705 7:126351213-126351235 TTGTCCAAGTTTGTTTCTGCTGG - Intergenic
1032446535 7:131988886-131988908 TCTGCCTTGTTTGTTTATAGTGG - Intergenic
1032635156 7:133698711-133698733 TGTGCCTTGTTTTTTTCTTATGG + Intronic
1032838332 7:135694082-135694104 TTTACCTGCTGTGTTTCTGCTGG + Intronic
1033718778 7:144034343-144034365 TGTTCCCTGTTTGTTTCTGATGG - Intergenic
1033978506 7:147132570-147132592 TGTGCTTTGTTTGGTTTTGCTGG + Intronic
1034118246 7:148603657-148603679 TATGACTTCTTTGTTTCTGTGGG - Intronic
1034284830 7:149877986-149878008 ACTGCTTTGTCTGTTTCTGCAGG - Intronic
1034837273 7:154364148-154364170 TTTGATTTGTTTGTTTTTACTGG - Intronic
1035118974 7:156549164-156549186 TGTGGCTTGTTGGTTTCCGCAGG - Intergenic
1035967619 8:4211199-4211221 TTTGCCTTTTTTTTTTTAGCTGG + Intronic
1037228404 8:16623544-16623566 TTTGCCTTCTTTTTTGTTGCAGG - Intergenic
1037268349 8:17095184-17095206 GTTCTGTTGTTTGTTTCTGCTGG + Intronic
1037399798 8:18483993-18484015 TTTGTCTTGTTTGGGTTTGCAGG - Intergenic
1039547432 8:38420225-38420247 GGTGCCTCGTTTATTTCTGCAGG + Intronic
1039695165 8:39902888-39902910 CTTGACTTGTTTGTTACTGGTGG + Intronic
1039987826 8:42462795-42462817 TTTGCAGTGCTTGTTTCTGGGGG + Intronic
1040517496 8:48146647-48146669 TTAGCCTTGTTTGGTTTTGTGGG - Intergenic
1040584208 8:48725131-48725153 TGTGCCTTGATTGTTCCTCCTGG - Intronic
1040828947 8:51655854-51655876 TTGGCCCTATGTGTTTCTGCTGG - Intronic
1040851273 8:51902394-51902416 TTTGCTTTTTTTTTTTTTGCAGG - Intergenic
1040869585 8:52087205-52087227 TTTGCTTTATTTTTTTCTGTGGG + Intergenic
1041604494 8:59764484-59764506 TTTACATTGTTTATTTCTTCTGG - Intergenic
1044574068 8:93749670-93749692 TTTGCCTGGGTTGTTTCTTAGGG - Intergenic
1044724864 8:95186163-95186185 TTTGCCTTTTTTGTAGATGCAGG + Intergenic
1045953440 8:107878542-107878564 TTTTCTTTGTTTGTTTCTTGAGG - Intergenic
1045960097 8:107957204-107957226 TTTGCCTTCATTCTTTCTGTGGG - Intronic
1046186772 8:110732034-110732056 TTTGTTTTGTTTGTTTTTGAAGG - Intergenic
1046501562 8:115084632-115084654 GTTGCTTTGTTTGTTTGTGATGG + Intergenic
1046638240 8:116696864-116696886 TTTGACTTTTTTGTGTGTGCAGG - Intronic
1047109460 8:121773049-121773071 TTTGCTTTGTTTATTTCTTATGG - Intergenic
1047401491 8:124552253-124552275 ATTGCAGTGTTTGTTTCTGTAGG - Intronic
1048798847 8:138177420-138177442 TTTACATTGTTTTATTCTGCAGG - Exonic
1049108965 8:140631051-140631073 TTTGTTTTGTTTGTTTCTGAGGG - Intronic
1050590071 9:7151393-7151415 CTGGCCTTGTTTGTTTCTAAAGG - Intergenic
1051529958 9:18090861-18090883 TTTTCCTTGCTTTTTTCTGGTGG + Intergenic
1052463143 9:28793606-28793628 TCTGCTTTGTTTGCTTCTGAAGG - Intergenic
1052759487 9:32575448-32575470 TTTTTTTTGTTTGTTTTTGCGGG - Intergenic
1053087931 9:35243739-35243761 ATTGCATTGTTTGTTCTTGCTGG + Intronic
1053243848 9:36518546-36518568 TTTGTTTTGTTTGTTTTTGATGG + Intergenic
1053723611 9:40974562-40974584 CTTGCTTTGTGTGTTTCGGCTGG - Intergenic
1054342348 9:63877434-63877456 CTTGCTTTGTGTGTTTCGGCTGG + Intergenic
1055295015 9:74825261-74825283 TTTGACTTTTTTGTTTTTTCTGG - Intronic
1055957518 9:81788011-81788033 TTGGCCTTGGTTGTCTCTGGTGG - Intergenic
1058060138 9:100486575-100486597 TTTGCATTTTCTGTTTATGCTGG + Intronic
1058517580 9:105792354-105792376 CTTGTCTTGTTTGGTTCTTCAGG + Intergenic
1059564238 9:115366994-115367016 TGTCCCTTGTTTATTTCTGTAGG + Intronic
1059632070 9:116135485-116135507 TTTATTATGTTTGTTTCTGCTGG - Intergenic
1059799780 9:117738470-117738492 TTTGCATTTTTTTTTTCTGCAGG - Intergenic
1059846972 9:118290731-118290753 GTTGCCTTGTTTGTTCTTCCAGG + Intergenic
1061401609 9:130371408-130371430 TTTGTTTTTTTTTTTTCTGCAGG - Intronic
1061917353 9:133762387-133762409 TTTGGCTTGTTTGTTTTTTAAGG - Exonic
1062642769 9:137529477-137529499 GTTGCCTTCTTTGTTTTAGCAGG + Intronic
1203448263 Un_GL000219v1:81769-81791 CTTGCTTTGTTTGTCTCTGTTGG - Intergenic
1203616117 Un_KI270749v1:66729-66751 TGTGCCTTGTTTCTTGCTTCTGG - Intergenic
1185495038 X:548116-548138 TTTTGTTTGTTTGTTTCTGATGG - Intergenic
1185974489 X:4704348-4704370 TTTGCTTTTTTTTTTTCTGTTGG - Intergenic
1186201010 X:7154824-7154846 TTTTCCTTATTTTTTTTTGCTGG - Intergenic
1186737627 X:12482213-12482235 TTTTCCTTGTTAGTTTCCTCAGG - Intronic
1186867084 X:13731452-13731474 TTTACATTTTTTGTTTCTGAAGG + Intronic
1186958599 X:14710216-14710238 GGTGAGTTGTTTGTTTCTGCAGG - Intronic
1187095345 X:16142022-16142044 TTTGTCTATTTTGTTTCAGCAGG - Intronic
1187465546 X:19524175-19524197 TTTGCCTTGTTTGTATATCGGGG + Intergenic
1188610542 X:32090758-32090780 TTTGGGTTTTTTTTTTCTGCTGG + Intronic
1188931862 X:36121622-36121644 TTTGGCTTGTTTGTTTGTTTAGG - Intronic
1189036591 X:37499977-37499999 TTTTATTTGTTTGTTTTTGCAGG + Intronic
1189052344 X:37659440-37659462 TATGCCTTGTTTGTTAATACAGG + Exonic
1189481771 X:41397552-41397574 TTTGGTTTGTTTGTTTTTGTGGG + Intergenic
1190417669 X:50197094-50197116 TTTATCTTTTTTCTTTCTGCAGG + Intronic
1191972685 X:66834066-66834088 TTTGCCTTATTTGTTTCATTTGG - Intergenic
1191995828 X:67094420-67094442 TTTGTGTTCTTTGTATCTGCCGG - Intergenic
1195542852 X:106082823-106082845 TTTTGCTTGTTTGTTTATGCAGG - Intergenic
1196965764 X:121053177-121053199 TTTGCTTTGTTTGTTCCTGATGG + Intergenic
1197569595 X:128132319-128132341 TTTGTTTTGTTTGTTTTTACAGG + Intergenic
1198514585 X:137392482-137392504 TTTGCTTTGTTTGTTTGAGATGG - Intergenic
1199028490 X:142969351-142969373 TTTGCTTTTTTGGTTTCTTCAGG - Intergenic
1199322695 X:146459598-146459620 TTTCCCTTGTTTGATTGTTCTGG - Intergenic
1199603593 X:149558778-149558800 TTTACCTTGCTGGTTTTTGCTGG + Intergenic
1199646794 X:149920696-149920718 TTTACCTTGCTGGTTTTTGCTGG - Intergenic
1199691810 X:150314199-150314221 TTTGTCTTGTTTGTTTGAGATGG - Intergenic
1200222826 X:154400101-154400123 CATGCTTTGTTTGTATCTGCAGG - Intronic
1200704210 Y:6427801-6427823 TTTTGTTTGTTTGTTTTTGCAGG + Intergenic
1200855506 Y:7933658-7933680 TTTGCCTTGTCTGTTCTTACAGG - Intergenic
1201029901 Y:9736907-9736929 TTTTGTTTGTTTGTTTTTGCAGG - Intergenic
1201681468 Y:16649002-16649024 TTTTGCTTGTTTGTTTTTGTTGG - Intergenic
1202250561 Y:22866898-22866920 TTTGACTTTTTTTTTTCTACAGG + Intergenic
1202265779 Y:23017038-23017060 TTTTGTTTGTTTGTTTCAGCTGG + Intergenic
1202403550 Y:24500647-24500669 TTTGACTTTTTTTTTTCTACAGG + Intergenic
1202418772 Y:24650780-24650802 TTTTGTTTGTTTGTTTCAGCTGG + Intergenic
1202452014 Y:25019306-25019328 TTTTGTTTGTTTGTTTCAGCTGG - Intergenic
1202467229 Y:25169435-25169457 TTTGACTTTTTTTTTTCTACAGG - Intergenic