ID: 1004720275

View in Genome Browser
Species Human (GRCh38)
Location 6:18263048-18263070
Sequence GACTCGGATTTTTAAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004720273_1004720275 16 Left 1004720273 6:18263009-18263031 CCGCAGACTAAGCTAATATCAAA 0: 1
1: 0
2: 0
3: 6
4: 169
Right 1004720275 6:18263048-18263070 GACTCGGATTTTTAAATGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004720275 Original CRISPR GACTCGGATTTTTAAATGTT TGG Intronic
906899646 1:49820114-49820136 CATTCTGATTTTTAAATGTCTGG - Intronic
908060029 1:60337531-60337553 GCTTCAGATTTTTAAAGGTTGGG - Intergenic
908954329 1:69603202-69603224 GAATAGGGTTTTTAAATCTTGGG - Intronic
909247129 1:73300474-73300496 TACACGGATTTTTAACTGTGTGG + Intergenic
912224334 1:107716162-107716184 GACCAGGATTTTTATAAGTTTGG + Intronic
916643542 1:166758581-166758603 GACTCAATTTTTTAAATGTTGGG + Intergenic
917750884 1:178052374-178052396 GACACAGATTTACAAATGTTTGG + Intergenic
917773569 1:178307926-178307948 GCCTCGGATTTACGAATGTTTGG - Intronic
918279482 1:182989918-182989940 GACTCTGAGTTTTAAATCCTAGG + Intergenic
919121795 1:193350204-193350226 GACTTGGTTTTTTACATGGTTGG + Intergenic
922941095 1:229466926-229466948 CACTCTGACTTTTAAAAGTTAGG - Intronic
924379981 1:243453637-243453659 CAATCGTATTTTGAAATGTTCGG + Intronic
1063278323 10:4596191-4596213 GACTCTGCTATTTAATTGTTAGG - Intergenic
1063760681 10:9071858-9071880 AATTCAGATTTCTAAATGTTGGG - Intergenic
1063772022 10:9214479-9214501 GTTTCAGATTTTGAAATGTTTGG + Intergenic
1064792802 10:18977477-18977499 GACTCATATTTTTAAATTTCAGG + Intergenic
1065477090 10:26151263-26151285 GAGAGGGATTTTTAAATATTTGG + Intronic
1066479547 10:35782295-35782317 GATTTGGATTTTTAATTCTTTGG + Intergenic
1066576739 10:36834109-36834131 TATTTGGATTTTTAAATATTTGG - Intergenic
1067100072 10:43328621-43328643 GAATTGGATTTTTAAAAATTGGG - Intergenic
1067688919 10:48488437-48488459 CACTGTGATTTTTAAATGGTTGG + Intronic
1069301722 10:66916052-66916074 GACATATATTTTTAAATGTTGGG + Intronic
1069859765 10:71463141-71463163 GACTCAGATATTTATATTTTGGG - Intronic
1071604504 10:86975744-86975766 TATTCTGATTTTTAAATGTTTGG + Intronic
1074050655 10:109878453-109878475 TCCTCCTATTTTTAAATGTTTGG - Intronic
1074673793 10:115825714-115825736 GACTAGTATTTATTAATGTTTGG - Intronic
1081494953 11:43598947-43598969 AACTCAGATTTTTAAATGTCTGG - Intronic
1082674354 11:56077502-56077524 GACTCTCCTTTTTAATTGTTTGG + Intergenic
1083127458 11:60585414-60585436 GAGTAGAATCTTTAAATGTTTGG - Intergenic
1085191342 11:74626525-74626547 TACACTGATTTTAAAATGTTAGG + Intronic
1086003381 11:82006643-82006665 AACTTGGCTTTTTAAATATTAGG + Intergenic
1086045781 11:82529620-82529642 GAGTCTCTTTTTTAAATGTTTGG + Intergenic
1086723319 11:90148525-90148547 GATTCATATATTTAAATGTTTGG - Intronic
1088601481 11:111481349-111481371 TAATCCTATTTTTAAATGTTTGG - Intronic
1091967697 12:4759193-4759215 TATTTGGATTTTTGAATGTTTGG + Intronic
1099318729 12:81118178-81118200 CACTCAAATTTTTAAATGTTAGG + Intronic
1099510548 12:83530307-83530329 GACTTCTATTTTCAAATGTTTGG - Intergenic
1100973545 12:100097380-100097402 GACTCTGATTTTTGATTGGTTGG + Exonic
1102969701 12:117156403-117156425 GTCTCATATTTTTACATGTTTGG - Intronic
1103315507 12:120051631-120051653 GTCTAGGATTTTAAAAAGTTAGG + Intronic
1104949901 12:132434981-132435003 GCCTCGGATGTTCAAATGGTAGG - Intergenic
1105581443 13:21700425-21700447 GAATCAGAGTTTTAAAGGTTTGG + Intronic
1106460872 13:29966725-29966747 GCCTCGGGTTATGAAATGTTAGG + Intergenic
1109937089 13:69301202-69301224 TACTAGGAATTTTAAATGTGAGG + Intergenic
1110239815 13:73254570-73254592 GAGACAGCTTTTTAAATGTTTGG - Intergenic
1111290542 13:86163032-86163054 GACCATTATTTTTAAATGTTAGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112119044 13:96389544-96389566 GAATAGCATTTTAAAATGTTAGG - Intronic
1116106654 14:40516337-40516359 CACTAGTCTTTTTAAATGTTTGG - Intergenic
1122080791 14:99266132-99266154 GAGTCGGCATTTTAAATCTTTGG + Intronic
1126652907 15:50944022-50944044 GACTCTGATTTTTAAGTGAAAGG - Intronic
1128413526 15:67422813-67422835 GACTCGTGTTTTAAAATGTCCGG + Intronic
1130017469 15:80198806-80198828 GACTCCTATTATTAAATATTTGG - Intergenic
1131644396 15:94326162-94326184 GAATCTGGCTTTTAAATGTTTGG + Intronic
1134902284 16:17949406-17949428 GACTAGGATTTTTAATTTCTTGG + Intergenic
1139454887 16:67066240-67066262 CACTTTGATTTTTGAATGTTGGG - Intronic
1142543158 17:677867-677889 GCCTCAGCCTTTTAAATGTTGGG - Intronic
1144468915 17:15519554-15519576 TACTCAGTTTTTTAAAGGTTGGG + Intronic
1146415754 17:32631095-32631117 GACTCTGATATATAAATTTTGGG + Intronic
1146518790 17:33510298-33510320 TCTTCTGATTTTTAAATGTTGGG - Intronic
1146755412 17:35427804-35427826 GACTCAGTTATTTCAATGTTTGG + Intronic
1148399589 17:47344308-47344330 TACTCTATTTTTTAAATGTTGGG + Intronic
1151566355 17:74900748-74900770 GATTCGGATCTTTATTTGTTGGG + Intergenic
1152050055 17:77966969-77966991 TACTAGAATTTTTAAATTTTAGG + Intergenic
1153014657 18:572820-572842 GACTTGCATTTTTAAAAATTCGG - Intergenic
1153363660 18:4228268-4228290 GAGTAGGATGTTTAAATGTTTGG - Intronic
1153833741 18:8945796-8945818 GACTAGGGTTTTTAAGGGTTTGG - Intergenic
1156296708 18:35798316-35798338 AAATCTGGTTTTTAAATGTTTGG - Intergenic
1157217017 18:45792657-45792679 AACTCTGATTTCCAAATGTTTGG + Intergenic
1158636204 18:59160511-59160533 AACTGGTATTTTAAAATGTTGGG + Intergenic
1159291168 18:66422794-66422816 GAATCAGTTCTTTAAATGTTTGG - Intergenic
1160761200 19:785604-785626 AACTCTTATTTTTAAATGTTGGG + Intergenic
1163043368 19:14619603-14619625 CCCTAGGATTTTTAAATGCTAGG - Intronic
1165621530 19:37252342-37252364 AAGTGGGATTTTTAAAGGTTGGG - Intergenic
1166015900 19:39979237-39979259 TATCCTGATTTTTAAATGTTGGG + Intronic
928767025 2:34659773-34659795 AAATCAGATTTTTAAATATTTGG - Intergenic
930181215 2:48359989-48360011 GTCTAAAATTTTTAAATGTTTGG + Intronic
930323036 2:49879451-49879473 AACTCTGATTTCCAAATGTTTGG + Intergenic
932044109 2:68329828-68329850 GCCTCATATTTTTAAATGGTTGG + Intergenic
937474161 2:122199881-122199903 TACTCAGATTTTTGACTGTTCGG - Intergenic
940394796 2:153175723-153175745 GACTCATATTTTTAAATGTAAGG + Intergenic
940406978 2:153315799-153315821 AACTCGAATTTTTAATTCTTTGG - Intergenic
941377492 2:164750003-164750025 TCCTCTGATTTCTAAATGTTGGG + Intronic
946964205 2:225019765-225019787 GATTGGGAGTTTTTAATGTTCGG + Intronic
947687456 2:232101241-232101263 GACACAGATTTTTAAATGGAAGG - Intronic
1170582297 20:17708416-17708438 GTATCCAATTTTTAAATGTTGGG - Intronic
1177972560 21:27808627-27808649 GACTTGGATTTTTAAAAAATGGG - Intergenic
1179669753 21:42938369-42938391 GACTTTTATTTTTAAATGTACGG + Intergenic
951872914 3:27385131-27385153 GACACATATTTTTAAATGTATGG - Intronic
952721503 3:36538158-36538180 GACTAAATTTTTTAAATGTTAGG - Intronic
957135407 3:76281465-76281487 TATTCGGTTTTTAAAATGTTTGG + Intronic
959470977 3:106750048-106750070 GGCTCACATTTTTATATGTTAGG + Intergenic
960067515 3:113389920-113389942 GATTGGTATTCTTAAATGTTTGG - Intronic
961769001 3:129234590-129234612 TACTCTGATTTTTAAATTTTTGG - Intergenic
962019131 3:131478516-131478538 GACTAAGATTTTTCAGTGTTTGG - Intronic
962236030 3:133707931-133707953 GAGTTGGGTTTTTAAATATTGGG + Intergenic
963185154 3:142407295-142407317 GCATTGAATTTTTAAATGTTTGG - Intronic
963931380 3:151007522-151007544 TTCCCTGATTTTTAAATGTTGGG + Intergenic
964502498 3:157363921-157363943 GACTTAGATTTTCAAAGGTTTGG - Intronic
965797812 3:172459652-172459674 GCCTCTGATCTCTAAATGTTTGG - Intergenic
967195094 3:187019241-187019263 CACTGGGATTGTGAAATGTTGGG + Intronic
970551769 4:17188882-17188904 GGCTCTGATTTTTAAAAATTAGG - Intergenic
971235192 4:24835150-24835172 GACTTGGAATTCTAAATATTAGG - Intronic
973690629 4:53426237-53426259 GTATCAGATTTTGAAATGTTTGG + Intronic
974740793 4:66004521-66004543 GTATCAGTTTTTTAAATGTTTGG + Intergenic
975987180 4:80211694-80211716 GAATTAGATTTTTGAATGTTAGG - Intergenic
979231236 4:118351741-118351763 GACTCCGATTTTTAAAAATGTGG - Intronic
980631522 4:135442129-135442151 AACTGGTATTCTTAAATGTTTGG - Intergenic
981117595 4:141010294-141010316 GAATTGGATTTTTGTATGTTGGG + Intronic
984000709 4:174239335-174239357 TACTTAGATTTTTTAATGTTGGG - Intronic
987524940 5:19035159-19035181 GACTCTGAGTTTTAATTCTTTGG + Intergenic
987932770 5:24424036-24424058 ATCTTGGATTCTTAAATGTTTGG - Intergenic
989427345 5:41312183-41312205 GACCCGGACTATTAAACGTTAGG + Exonic
989777573 5:45227143-45227165 GACTCTGAATTTTTAATGGTAGG + Intergenic
993009921 5:82469080-82469102 GACTGGGATTTTTGACTGTCTGG + Intergenic
993645822 5:90459892-90459914 AAATCAGATTTTTTAATGTTAGG - Exonic
995994826 5:118285108-118285130 GATACAGATTTTTAAATCTTAGG - Intergenic
996229600 5:121045388-121045410 GAGTCAGATTTATAAATGTAAGG - Intergenic
996340538 5:122434084-122434106 GAATAGGATTTTCAAATGATCGG + Intronic
1003818386 6:9867222-9867244 CTCTCGTATTTTTAAATGTTTGG - Intronic
1004720275 6:18263048-18263070 GACTCGGATTTTTAAATGTTTGG + Intronic
1004750676 6:18558684-18558706 GCCTTGAATTTTAAAATGTTGGG - Intergenic
1008801732 6:55376939-55376961 TAGTCGGCTTTTTCAATGTTAGG + Intronic
1010808688 6:80270914-80270936 AACATGTATTTTTAAATGTTTGG + Intronic
1014819115 6:125966535-125966557 GACACATATTTTTAAAGGTTTGG - Intronic
1015749660 6:136547714-136547736 AAATAGGGTTTTTAAATGTTGGG + Intronic
1017486843 6:154910830-154910852 TACTTGTATTTTTAAAAGTTTGG - Intronic
1022486389 7:30781611-30781633 GACTCCGTTTTTTAAATGAAGGG + Intronic
1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG + Intergenic
1026621945 7:71957260-71957282 GACTGTGACTTTTAAATTTTTGG + Intronic
1030234316 7:107242344-107242366 GACTCGGATTTTCCAGTGCTTGG - Intronic
1030515539 7:110533665-110533687 GACTTGGAGTTTTATATGTTGGG - Intergenic
1039905331 8:41782030-41782052 AACTGGGATTTTTAAAGGCTAGG + Intronic
1040646907 8:49408707-49408729 GATGCAGATTTTTAAAAGTTTGG + Intergenic
1043601601 8:81945704-81945726 AAATCAGATTTTGAAATGTTAGG + Intergenic
1044935503 8:97289831-97289853 GATTCGGATTTGGACATGTTTGG + Intergenic
1046911944 8:119638175-119638197 TACTCAAATTTGTAAATGTTAGG - Intronic
1051868510 9:21709553-21709575 GACTCTGATTTTTGAAAATTTGG - Intergenic
1057492260 9:95529584-95529606 GACACGGAATTTTGAATTTTGGG - Intergenic
1060309326 9:122445303-122445325 ACCTCTGATTTTTACATGTTTGG - Intergenic
1061340843 9:129980054-129980076 CACTCTGATTTTTAAACATTTGG - Intronic
1061440567 9:130600385-130600407 GATTTGCATTTTTAAATTTTGGG + Intronic
1189338645 X:40187265-40187287 GAGCCGGATTGTTAAATATTTGG - Intergenic
1189899750 X:45693889-45693911 GACTGGGATTTTTGTATGTTTGG - Intergenic
1194590385 X:95793260-95793282 CAGTCTGATTTTTAAATGTTAGG + Intergenic
1199999492 X:153050782-153050804 GACTCTGACTTTTTAATATTGGG + Intergenic
1200421446 Y:2973624-2973646 AAATTGGATTTTTCAATGTTTGG - Intronic