ID: 1004720593

View in Genome Browser
Species Human (GRCh38)
Location 6:18264700-18264722
Sequence TGCGCGCGCGGGGCTCTCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004720588_1004720593 -2 Left 1004720588 6:18264679-18264701 CCTCGGCCGCGGGCGGAGGGATG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1004720593 6:18264700-18264722 TGCGCGCGCGGGGCTCTCCCCGG 0: 1
1: 0
2: 3
3: 10
4: 121
1004720582_1004720593 11 Left 1004720582 6:18264666-18264688 CCGCGAGGGGTCGCCTCGGCCGC 0: 1
1: 0
2: 2
3: 6
4: 79
Right 1004720593 6:18264700-18264722 TGCGCGCGCGGGGCTCTCCCCGG 0: 1
1: 0
2: 3
3: 10
4: 121
1004720589_1004720593 -8 Left 1004720589 6:18264685-18264707 CCGCGGGCGGAGGGATGCGCGCG 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1004720593 6:18264700-18264722 TGCGCGCGCGGGGCTCTCCCCGG 0: 1
1: 0
2: 3
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004720593 Original CRISPR TGCGCGCGCGGGGCTCTCCC CGG Exonic