ID: 1004722222

View in Genome Browser
Species Human (GRCh38)
Location 6:18277511-18277533
Sequence CTGCTCCTTACTTGGACCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004722205_1004722222 27 Left 1004722205 6:18277461-18277483 CCCGAGCGCGCGCGCGCCTTGGC No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data
1004722214_1004722222 -2 Left 1004722214 6:18277490-18277512 CCTGCGCCTCCCGGGGTCTCCCT No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data
1004722203_1004722222 28 Left 1004722203 6:18277460-18277482 CCCCGAGCGCGCGCGCGCCTTGG No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data
1004722213_1004722222 -1 Left 1004722213 6:18277489-18277511 CCCTGCGCCTCCCGGGGTCTCCC No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data
1004722209_1004722222 11 Left 1004722209 6:18277477-18277499 CCTTGGCGGGAGCCCTGCGCCTC No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data
1004722206_1004722222 26 Left 1004722206 6:18277462-18277484 CCGAGCGCGCGCGCGCCTTGGCG No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data
1004722215_1004722222 -8 Left 1004722215 6:18277496-18277518 CCTCCCGGGGTCTCCCTGCTCCT No data
Right 1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004722222 Original CRISPR CTGCTCCTTACTTGGACCTC GGG Intergenic
No off target data available for this crispr