ID: 1004723513

View in Genome Browser
Species Human (GRCh38)
Location 6:18289690-18289712
Sequence AGTCATGACAATGGGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004723513_1004723519 14 Left 1004723513 6:18289690-18289712 CCTCAACACCCATTGTCATGACT No data
Right 1004723519 6:18289727-18289749 GCCCTTAAGCCTTCATTTCTGGG No data
1004723513_1004723516 -8 Left 1004723513 6:18289690-18289712 CCTCAACACCCATTGTCATGACT No data
Right 1004723516 6:18289705-18289727 TCATGACTCCTTTTCATAGTTGG No data
1004723513_1004723521 15 Left 1004723513 6:18289690-18289712 CCTCAACACCCATTGTCATGACT No data
Right 1004723521 6:18289728-18289750 CCCTTAAGCCTTCATTTCTGGGG No data
1004723513_1004723524 30 Left 1004723513 6:18289690-18289712 CCTCAACACCCATTGTCATGACT No data
Right 1004723524 6:18289743-18289765 TTCTGGGGTTATTTAACTATTGG No data
1004723513_1004723518 13 Left 1004723513 6:18289690-18289712 CCTCAACACCCATTGTCATGACT No data
Right 1004723518 6:18289726-18289748 GGCCCTTAAGCCTTCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004723513 Original CRISPR AGTCATGACAATGGGTGTTG AGG (reversed) Intergenic
No off target data available for this crispr