ID: 1004726049

View in Genome Browser
Species Human (GRCh38)
Location 6:18312246-18312268
Sequence ATTTGGGAGCTGAATGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004726038_1004726049 30 Left 1004726038 6:18312193-18312215 CCTAGTAAGAAGGTTGGGATGGG No data
Right 1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004726049 Original CRISPR ATTTGGGAGCTGAATGAACA GGG Intergenic
No off target data available for this crispr