ID: 1004726341

View in Genome Browser
Species Human (GRCh38)
Location 6:18314685-18314707
Sequence TTGGATTAACTAGGGAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004726337_1004726341 11 Left 1004726337 6:18314651-18314673 CCTTGATTTTTCTCTTTAAAAAG No data
Right 1004726341 6:18314685-18314707 TTGGATTAACTAGGGAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004726341 Original CRISPR TTGGATTAACTAGGGAGCAA TGG Intergenic
No off target data available for this crispr