ID: 1004727508

View in Genome Browser
Species Human (GRCh38)
Location 6:18325468-18325490
Sequence GTTTCAGTGAGGAATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004727502_1004727508 -7 Left 1004727502 6:18325452-18325474 CCTAGGACTAAAACTGGTTTCAG No data
Right 1004727508 6:18325468-18325490 GTTTCAGTGAGGAATGGGGGAGG No data
1004727498_1004727508 30 Left 1004727498 6:18325415-18325437 CCTAGTAGAACCAGAGAATATGA No data
Right 1004727508 6:18325468-18325490 GTTTCAGTGAGGAATGGGGGAGG No data
1004727499_1004727508 20 Left 1004727499 6:18325425-18325447 CCAGAGAATATGAATAGATGCTG No data
Right 1004727508 6:18325468-18325490 GTTTCAGTGAGGAATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004727508 Original CRISPR GTTTCAGTGAGGAATGGGGG AGG Intergenic
No off target data available for this crispr