ID: 1004729968

View in Genome Browser
Species Human (GRCh38)
Location 6:18348020-18348042
Sequence AGAAGTACCTTTCAATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004729968_1004729972 27 Left 1004729968 6:18348020-18348042 CCACCAAATTGAAAGGTACTTCT No data
Right 1004729972 6:18348070-18348092 GCTTAGCAGCAGAGAGCTGGAGG No data
1004729968_1004729971 24 Left 1004729968 6:18348020-18348042 CCACCAAATTGAAAGGTACTTCT No data
Right 1004729971 6:18348067-18348089 TGAGCTTAGCAGCAGAGAGCTGG No data
1004729968_1004729970 -8 Left 1004729968 6:18348020-18348042 CCACCAAATTGAAAGGTACTTCT No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004729968 Original CRISPR AGAAGTACCTTTCAATTTGG TGG (reversed) Intergenic
No off target data available for this crispr