ID: 1004729970

View in Genome Browser
Species Human (GRCh38)
Location 6:18348035-18348057
Sequence GTACTTCTCAAAGTAATCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004729961_1004729970 12 Left 1004729961 6:18348000-18348022 CCTTCCACACTTCCCTCCCTCCA No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729964_1004729970 -1 Left 1004729964 6:18348013-18348035 CCTCCCTCCACCAAATTGAAAGG No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729963_1004729970 0 Left 1004729963 6:18348012-18348034 CCCTCCCTCCACCAAATTGAAAG No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729967_1004729970 -5 Left 1004729967 6:18348017-18348039 CCTCCACCAAATTGAAAGGTACT No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729960_1004729970 16 Left 1004729960 6:18347996-18348018 CCAGCCTTCCACACTTCCCTCCC No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729968_1004729970 -8 Left 1004729968 6:18348020-18348042 CCACCAAATTGAAAGGTACTTCT No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729962_1004729970 8 Left 1004729962 6:18348004-18348026 CCACACTTCCCTCCCTCCACCAA No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data
1004729966_1004729970 -4 Left 1004729966 6:18348016-18348038 CCCTCCACCAAATTGAAAGGTAC No data
Right 1004729970 6:18348035-18348057 GTACTTCTCAAAGTAATCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004729970 Original CRISPR GTACTTCTCAAAGTAATCAG CGG Intergenic
No off target data available for this crispr