ID: 1004729972

View in Genome Browser
Species Human (GRCh38)
Location 6:18348070-18348092
Sequence GCTTAGCAGCAGAGAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004729969_1004729972 24 Left 1004729969 6:18348023-18348045 CCAAATTGAAAGGTACTTCTCAA No data
Right 1004729972 6:18348070-18348092 GCTTAGCAGCAGAGAGCTGGAGG No data
1004729967_1004729972 30 Left 1004729967 6:18348017-18348039 CCTCCACCAAATTGAAAGGTACT No data
Right 1004729972 6:18348070-18348092 GCTTAGCAGCAGAGAGCTGGAGG No data
1004729968_1004729972 27 Left 1004729968 6:18348020-18348042 CCACCAAATTGAAAGGTACTTCT No data
Right 1004729972 6:18348070-18348092 GCTTAGCAGCAGAGAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004729972 Original CRISPR GCTTAGCAGCAGAGAGCTGG AGG Intergenic
No off target data available for this crispr