ID: 1004730483

View in Genome Browser
Species Human (GRCh38)
Location 6:18353361-18353383
Sequence ATGTATAAACTGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004730478_1004730483 3 Left 1004730478 6:18353335-18353357 CCACAAGAATTAGAACCATTGTT No data
Right 1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG No data
1004730477_1004730483 13 Left 1004730477 6:18353325-18353347 CCTATGGTTGCCACAAGAATTAG No data
Right 1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004730483 Original CRISPR ATGTATAAACTGATGGAGGA GGG Intergenic
No off target data available for this crispr