ID: 1004734266

View in Genome Browser
Species Human (GRCh38)
Location 6:18389187-18389209
Sequence CTGAAACCATTCATGAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004734266_1004734271 17 Left 1004734266 6:18389187-18389209 CCCATTCTCATGAATGGTTTCAG 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1004734271 6:18389227-18389249 GGCATTCAGGCTTCCAAACTAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1004734266_1004734269 -4 Left 1004734266 6:18389187-18389209 CCCATTCTCATGAATGGTTTCAG 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1004734269 6:18389206-18389228 TCAGTTCATTGGCAATTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 177
1004734266_1004734270 4 Left 1004734266 6:18389187-18389209 CCCATTCTCATGAATGGTTTCAG 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1004734270 6:18389214-18389236 TTGGCAATTTAAAGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004734266 Original CRISPR CTGAAACCATTCATGAGAAT GGG (reversed) Intronic
907627195 1:56041798-56041820 CTAATACCATTCATGAGGCTGGG + Intergenic
907740178 1:57157843-57157865 ATAAAACAATTTATGAGAATGGG - Intronic
909978828 1:82073818-82073840 TTGAAACCATTAAAGAGAAAAGG - Intergenic
910260098 1:85285698-85285720 CTGACTCCAGTCATGGGAATGGG - Intergenic
912797664 1:112702674-112702696 CAGAAAACATTCCTGAGAAGTGG - Exonic
913064259 1:115235514-115235536 CTTAAACCATTCATAAGACCAGG - Intergenic
913478472 1:119261693-119261715 CTGTAACCATAGATGAGGATGGG - Intergenic
919214176 1:194530952-194530974 TTGAAAGCATTCCTGAGAACTGG - Intergenic
920875927 1:209835665-209835687 CTGATGCCATTCATGAGAGTTGG + Intronic
921514833 1:216077149-216077171 CTGAGAGCTTACATGAGAATAGG - Intronic
921571831 1:216788843-216788865 TTAAAGTCATTCATGAGAATTGG - Intronic
921588612 1:216977822-216977844 ATGAATCCATTCATGAGGACCGG - Intronic
924116496 1:240753011-240753033 CTGGAACATTTCATTAGAATTGG - Intergenic
1066252532 10:33648538-33648560 CTGAATATATTCATGAGAAGAGG - Intergenic
1068626305 10:59252242-59252264 CTGAAACCATACATGAGTTTGGG - Intronic
1071053970 10:81487282-81487304 GCCAAACCATTCATGAGAAACGG + Intergenic
1073421633 10:103428520-103428542 CTGAAACCATTAATATGAAGAGG - Intronic
1073622979 10:105067970-105067992 CTGGAAGCATTGATGAGAGTGGG - Intronic
1074460247 10:113630058-113630080 CTTAAAGCATCTATGAGAATTGG - Intronic
1075186644 10:120265648-120265670 CTGAAACCATTCTTCAAAAATGG + Intergenic
1076227256 10:128789076-128789098 CATAAACCATGCATGTGAATTGG + Intergenic
1076345522 10:129776285-129776307 CTGGAAACATTCAGTAGAATGGG + Intergenic
1082031060 11:47603877-47603899 TTGAAATCCTTCATGAGACTGGG - Intergenic
1084577321 11:69997684-69997706 GCCAAACCATTCATGAGAAACGG - Intergenic
1086010024 11:82090987-82091009 CTAAAACAATTCCTTAGAATGGG + Intergenic
1088378891 11:109171734-109171756 CTGAAATCATTCCTGAGCTTAGG + Intergenic
1089080288 11:115770644-115770666 CAGAAAACATTCATGAGGTTTGG - Intergenic
1090943916 11:131412908-131412930 CTAAAACCATTGATGACAAAAGG - Intronic
1091217392 11:133911159-133911181 CTAAAACCATTCATGAAAAGAGG + Intronic
1092334708 12:7620831-7620853 CTGAAACCATTGATTAGAATAGG - Intergenic
1092505086 12:9090483-9090505 CTGAAACCACACATAAGAAAGGG + Intronic
1093434068 12:19115456-19115478 ATGAAACCATTTCTGAGAAGAGG - Intergenic
1093670427 12:21867912-21867934 CTGAAACTATTCATCAGATAAGG + Intronic
1094295524 12:28900566-28900588 CTAAAAACATACCTGAGAATGGG - Intergenic
1096219430 12:49819808-49819830 CTGAAACCGTTTTTCAGAATTGG + Intronic
1098222076 12:68280851-68280873 TAGAAACCATTCATGTGATTTGG + Intronic
1098242418 12:68481710-68481732 TAGAAACCATTCAAAAGAATTGG + Intergenic
1099301678 12:80902937-80902959 GTCAAACCATTCTTGAGAACTGG - Intronic
1099925708 12:89013976-89013998 CTAAAACTATTCATGAGAAGTGG - Intergenic
1099946665 12:89252883-89252905 ATAAAAACATTCATGAGATTAGG - Intergenic
1101769113 12:107732163-107732185 CTGAAAACATTCATGTCAAAGGG + Intergenic
1105222552 13:18345692-18345714 CAGAAACCCTTCATAAGAAACGG - Intergenic
1105399165 13:20072586-20072608 CTGAAAGAATTTGTGAGAATTGG + Intronic
1106483357 13:30153388-30153410 CAGAATCCATTAAGGAGAATGGG - Intergenic
1107077723 13:36341669-36341691 CAGAAAGCATTCATTAAAATTGG + Intronic
1108469098 13:50750551-50750573 TTCAACCCATTCATGAGCATGGG + Intronic
1113795053 13:113051907-113051929 ATGAATCCATTCATGAGGGTGGG + Intronic
1115150339 14:30277335-30277357 CTGAAAGCAATTATGAGAAAGGG - Intergenic
1115807370 14:37066107-37066129 CTTAACCGATTCATCAGAATTGG + Intronic
1116672074 14:47855669-47855691 CTGAAACGAATCATGATAACAGG + Intergenic
1117979300 14:61326730-61326752 CAGAAAATATTTATGAGAATGGG + Intronic
1118935666 14:70285526-70285548 CTGAGACATTACATGAGAATAGG - Intergenic
1119606665 14:76024221-76024243 CTGAAACCATCCCTGAGATGTGG - Intronic
1124879539 15:33628514-33628536 CTGAAAACATCCATGAGCTTTGG + Exonic
1127160003 15:56172403-56172425 ATTTAACTATTCATGAGAATAGG + Intronic
1127228737 15:56965134-56965156 GTGAAACCTTTCTTGAGAATGGG + Intronic
1128621330 15:69152777-69152799 CTCAACCTATTCCTGAGAATAGG - Intergenic
1129953306 15:79610975-79610997 CTGTATCCATTTATCAGAATAGG - Intergenic
1131546137 15:93317047-93317069 CTGGAGCCATTCAAGAGAAGGGG + Intergenic
1131911933 15:97215728-97215750 CTGAAACTAATAATCAGAATAGG + Intergenic
1134399582 16:13897063-13897085 CTAAACCCATTGATGAGACTAGG - Intergenic
1137494707 16:48960877-48960899 CTGCAACCCTTTATGAGAAATGG - Intergenic
1138920181 16:61517983-61518005 CAGCAACCATTCATGGGAAAGGG - Intergenic
1140429214 16:74887337-74887359 CTGAAAGCATTCATGGGAAGCGG + Intronic
1144262466 17:13535833-13535855 TAGAAACCATTCATCAGCATTGG - Intronic
1144414240 17:15031352-15031374 CTGAACCAATTCCTGTGAATAGG - Intergenic
1147306471 17:39567807-39567829 CTGAAATCATTCATGTGAGCTGG + Intergenic
1147938830 17:44030791-44030813 GTGAAGCCATTCTTGACAATTGG - Intergenic
1149937727 17:60825765-60825787 CTAATCCCATTCATGAGATTGGG + Intronic
1150887201 17:69100864-69100886 CTGATAATATTCATAAGAATTGG + Exonic
1151006931 17:70448763-70448785 CTCATCCCATTCATGAGGATGGG + Intergenic
1152629229 17:81402518-81402540 CTGAAGCCATCCAGGAAAATGGG - Intronic
1153259693 18:3211480-3211502 CTGAAACCATTCATGGACAGAGG + Intronic
1155670954 18:28370406-28370428 GGGAAACCATTCCTAAGAATGGG - Intergenic
1156831110 18:41492136-41492158 CTGGAACCATTTGTGAAAATGGG - Intergenic
1161248443 19:3267880-3267902 GTGAAACCAAACCTGAGAATGGG + Intronic
1162923587 19:13918594-13918616 CTGAAACCATCCCAGAGAGTGGG - Intronic
1166074777 19:40407608-40407630 CAGAAACCCTTCATCAGAAGAGG - Intronic
1166836402 19:45670414-45670436 CTGAAAACCTTCAAGAAAATTGG - Intronic
926676041 2:15621173-15621195 CTCACATCCTTCATGAGAATAGG - Intronic
928871544 2:35986977-35986999 TTGGCACCATTCATCAGAATGGG + Intergenic
933123784 2:78576962-78576984 CTGAAATTATTCACGAGAAGGGG + Intergenic
940028229 2:149231485-149231507 TTGTAACCATCCATGAGAATGGG - Intergenic
940532162 2:154891859-154891881 CAGAAACCATTTAAGAGAAGAGG - Intergenic
942544087 2:177044605-177044627 CTGAAAATAATCATGTGAATGGG - Intergenic
942624094 2:177880637-177880659 CTGACACCATTTATGAGTTTTGG - Intronic
944548369 2:200821053-200821075 CTAAAAACATCCATGAGAAATGG - Intronic
944855583 2:203764029-203764051 CTGAAAACATTCGAGAGAAGGGG + Intergenic
945583096 2:211621987-211622009 CTGCAATCAATCATTAGAATGGG + Intronic
945825221 2:214713308-214713330 CTGAAACCATGAATGGGAAATGG - Intergenic
948009797 2:234642418-234642440 TTAAAAACATTCATAAGAATTGG + Intergenic
948649353 2:239430453-239430475 CCGAAATCATTCATGAGCTTTGG + Intergenic
1173052869 20:39581659-39581681 GTGAAACCAGTGATGAGAAATGG + Intergenic
1173537149 20:43824239-43824261 CTGAAACCCTTCAAGGGGATGGG - Intergenic
1174308044 20:49628702-49628724 CTGAAAATTTTGATGAGAATGGG + Intergenic
1174778227 20:53365046-53365068 CAGAAACCATTCTTGAGACAGGG + Intronic
1176731101 21:10498116-10498138 CAGAAACCCTTCATAAGAAACGG - Intergenic
1177445986 21:21196850-21196872 GTTAAATCATTCATGAGAAACGG - Intronic
1178284347 21:31312634-31312656 CTGAATCCATCCATAATAATAGG + Intronic
1179946173 21:44678288-44678310 GTTAAACCATTCATGAGAAATGG - Intronic
1181405445 22:22681316-22681338 CTGACATCACTCATGAGAATTGG + Intergenic
1181429044 22:22866549-22866571 CTGATGTCATTCATGAAAATTGG + Intronic
1182142684 22:27975132-27975154 CTGAAACCAGTGAAGAGTATAGG - Intergenic
1185300831 22:50079852-50079874 CTGACACCATTCGTGGGAGTGGG + Intronic
949547817 3:5087333-5087355 TTGAAGCCATTCTTGACAATTGG - Intergenic
949901666 3:8820132-8820154 ATTAACCCATTCATGAGAGTGGG + Intronic
951506818 3:23456262-23456284 CTCAAATCATCCATGAGAGTTGG + Intronic
951523070 3:23627306-23627328 CTATAACCATACATGAGACTGGG + Intergenic
951862982 3:27274480-27274502 CTAAAATCATTCTTCAGAATGGG + Intronic
953277096 3:41512649-41512671 CTCTACCCATTCATGAGCATGGG - Intronic
957328817 3:78732676-78732698 GTGACACCATGCATGTGAATAGG + Intronic
957732075 3:84151592-84151614 CTTAAAGCATTCCTGAGACTTGG - Intergenic
958103558 3:89045453-89045475 CAGAAACCCTTCATGAGAGGAGG - Intergenic
960322373 3:116251993-116252015 GTTAAACAATTCATGAGATTTGG - Intronic
963455690 3:145543733-145543755 GTTAAACCATTCATGAGAAATGG - Intergenic
963559191 3:146839444-146839466 TGTTAACCATTCATGAGAATGGG - Intergenic
963582353 3:147142017-147142039 ATGAAACTATTCATGTAAATGGG + Intergenic
963634979 3:147783233-147783255 TTCTACCCATTCATGAGAATGGG + Intergenic
965170317 3:165254467-165254489 CTGAAAATATTCTTTAGAATAGG + Intergenic
965449063 3:168814847-168814869 ATGAAACCTTTCATAAGAAATGG - Intergenic
967368920 3:188720464-188720486 CTGAAATAGTTCATGAGAAGAGG + Intronic
969142659 4:5092768-5092790 GCTAAACCATTCATGAGAAACGG + Intronic
971588805 4:28440467-28440489 CTGATACCATTAATTAGAAGTGG + Intergenic
975297896 4:72754980-72755002 CTGAAACTATTCCAGAAAATTGG + Intergenic
975907446 4:79231016-79231038 CTAAAACACTTCATGAGAGTAGG + Intronic
976360928 4:84177292-84177314 ATGAAAACATACATGAGACTGGG + Intergenic
976437349 4:85033358-85033380 ATTAACCCATTCTTGAGAATGGG + Intergenic
976910003 4:90291478-90291500 AAGAAAGCATTCATGAGAAAAGG - Intronic
977024424 4:91798116-91798138 CAGAAACCAGTAAAGAGAATTGG + Intergenic
978636804 4:110819187-110819209 GTGTCACCATTCATGACAATGGG - Intergenic
980895674 4:138857472-138857494 CTGAAAACATTGAGCAGAATAGG - Intergenic
982379380 4:154733264-154733286 GTGAAACCCTTCATAGGAATGGG - Intronic
982946175 4:161626822-161626844 TTGAAGCCATCCATGAGGATTGG - Intronic
983061328 4:163165045-163165067 CTGAAATCATTAATGTGTATGGG - Intronic
983727855 4:170952132-170952154 ATAAAACCATTCAAGTGAATGGG - Intergenic
984832663 4:183989866-183989888 CTGAAACCATCCATGTGATGAGG - Intronic
985648493 5:1096505-1096527 CTGAAACCATTGAAGAGGAGTGG - Intronic
988018628 5:25594967-25594989 CTGGAACCATCCATGAGAAAGGG + Intergenic
988085879 5:26475185-26475207 CTTAAATCACTCTTGAGAATGGG - Intergenic
989513727 5:42318174-42318196 CACAAACCCTGCATGAGAATTGG - Intergenic
989822971 5:45817810-45817832 ATGAAAAAAGTCATGAGAATGGG + Intergenic
990005779 5:50942818-50942840 TTCTAACCATTCATGAGCATGGG - Intergenic
991187927 5:63832302-63832324 CAGAAACCTTTCATCAGACTGGG - Intergenic
992244976 5:74811458-74811480 CTAAATCCATACATGAGAGTGGG - Intronic
992757051 5:79917289-79917311 CTGAAACTATTCCTGAAAATTGG + Intergenic
992984287 5:82211706-82211728 CTGAAAGCAATCAGGAGAGTGGG - Intronic
993086057 5:83365200-83365222 CTGAAACAATTTATTTGAATGGG - Intergenic
994190277 5:96861529-96861551 CTGAAAGCCTTAATCAGAATTGG + Intronic
994552603 5:101256649-101256671 CTGAAGGCATTCAAGAGAAAAGG + Intergenic
994659317 5:102634752-102634774 TTCTACCCATTCATGAGAATGGG - Intergenic
995989546 5:118220603-118220625 TTAAAATCATTCATGAGAGTTGG + Intergenic
998043976 5:138971648-138971670 GTGAAACCATTGGTGTGAATGGG - Intronic
999281528 5:150369518-150369540 CTGACACCATCCCTGAGGATCGG - Exonic
1000924556 5:167177961-167177983 CTGTTACCATTCATGTTAATAGG - Intergenic
1001681358 5:173559510-173559532 TTGAAAGAATTTATGAGAATGGG - Intergenic
1002261542 5:177996727-177996749 CTGAACCCACTCCGGAGAATGGG + Intergenic
1003529053 6:6922522-6922544 ATTAATCCATTCATGAGAGTGGG + Intergenic
1003534991 6:6969014-6969036 CTGAATCCATTCATGAGTCCAGG - Intergenic
1004734266 6:18389187-18389209 CTGAAACCATTCATGAGAATGGG - Intronic
1005455921 6:26019905-26019927 CTGAAACCTTTCACAAGAATTGG - Intergenic
1005506144 6:26470406-26470428 CTGAAACCATATTTGAGAGTTGG + Intronic
1005930231 6:30477939-30477961 TTCAACCCATTCATGAGCATGGG - Intergenic
1006079458 6:31556915-31556937 CTGAAACCATATATCAGACTGGG - Intronic
1007280644 6:40709872-40709894 ATTAATCCACTCATGAGAATTGG + Intergenic
1010372021 6:75121469-75121491 ATGAAAGAATTCATGAGATTTGG - Intronic
1011269082 6:85557680-85557702 TTGAAACCATTAAGGAGAAAGGG + Intronic
1011744263 6:90394240-90394262 CTGAAATTCTTCATGAGAAACGG + Intergenic
1011837411 6:91450504-91450526 CTGAAATCATGCATGTGAAGGGG - Intergenic
1011883128 6:92057372-92057394 ATTAATTCATTCATGAGAATGGG + Intergenic
1012667706 6:101996845-101996867 TTGACAACATTCATGAAAATTGG - Intronic
1016281251 6:142421690-142421712 CTGTTTCCATTAATGAGAATTGG + Intronic
1016649715 6:146449396-146449418 ATGAAAACATACATGAGACTGGG + Intergenic
1016660659 6:146575425-146575447 GTGAAACCCTTCATGATATTGGG + Intergenic
1019172961 6:170144905-170144927 CAGAAACCAACCATCAGAATAGG - Intergenic
1020818021 7:12930019-12930041 CTGGAAAAATTCATGAAAATGGG - Intergenic
1020841937 7:13228968-13228990 GTGACAACATTCATGAGTATGGG + Intergenic
1021194867 7:17664044-17664066 TTGAATCCATTCATGATAAAGGG + Intergenic
1021415223 7:20376247-20376269 CTGAAACCACTGATGGGAAGTGG + Intronic
1023471964 7:40532185-40532207 ATCAAATCATTCATGAGCATTGG - Intronic
1024106435 7:46092414-46092436 CTGAAACTATTCCAGAAAATTGG - Intergenic
1024488036 7:49942835-49942857 CTGAACCCATGCACAAGAATTGG + Intronic
1024665213 7:51539573-51539595 TTGTACCCATTCATGAGCATGGG + Intergenic
1024875874 7:54022468-54022490 TTCTAACCATTCATGAGCATGGG + Intergenic
1025717866 7:63980187-63980209 CTTAAAAAATTTATGAGAATTGG + Intergenic
1028300385 7:89192600-89192622 CTGAAACTATTCCAGAAAATTGG + Intronic
1031233623 7:119143289-119143311 ATGAAACCTTTCCTCAGAATAGG + Intergenic
1031614577 7:123865807-123865829 ATGAAAACATTCCTGAGACTGGG + Intronic
1033787113 7:144745821-144745843 CTGAAACCAATCAAAACAATTGG + Intronic
1034598478 7:152223405-152223427 CAGAAACCCTTCATAAGAAACGG + Intronic
1034691837 7:153020282-153020304 CTGAAACCAGTCACAAGATTGGG + Intergenic
1036183317 8:6603232-6603254 CTGAAACTATTCATGTTAATGGG - Intronic
1039083615 8:33758327-33758349 CTGATAACATTCCTGTGAATTGG + Intergenic
1041740579 8:61152637-61152659 CTGATCCCATCCATGAGAGTGGG + Intronic
1047116764 8:121851208-121851230 CTGAAAACAATGATGAGAAATGG + Intergenic
1048346848 8:133582400-133582422 CTGAAGGCATTCTTGAGCATTGG + Intergenic
1048605032 8:135959241-135959263 CTCAAGTCATTCATGAGAATTGG - Intergenic
1049338214 8:142097763-142097785 CTGAAATCTTGCATGGGAATGGG + Intergenic
1050986886 9:12093453-12093475 CTGAAATGTTTTATGAGAATGGG + Intergenic
1051251236 9:15161087-15161109 ATTAATCCATTCATGAGGATGGG + Intergenic
1051457726 9:17279857-17279879 ATTAATTCATTCATGAGAATTGG - Intronic
1055367596 9:75561957-75561979 CTGAAACCATTCCAAAAAATTGG - Intergenic
1056740206 9:89247945-89247967 CTGAAGCCATTCATAAGAGGAGG - Intergenic
1058644398 9:107117123-107117145 GTGTAAGCATTCATGAGAAGAGG - Intergenic
1192254760 X:69446882-69446904 ATGACACCATTAGTGAGAATTGG + Intergenic
1192719891 X:73683128-73683150 ATGAAACAATTATTGAGAATGGG + Exonic
1194480688 X:94419299-94419321 CTGAAATCATAAATGAAAATGGG - Intergenic
1196365642 X:114920870-114920892 CTGAAAGAATACCTGAGAATGGG + Intergenic
1197256161 X:124265516-124265538 CTGATACCACTGATGAAAATGGG - Intronic
1198329782 X:135611594-135611616 CTTCTACCATTCATGAAAATAGG - Intergenic
1199548017 X:149028667-149028689 CTGAAACCATGGATGAGAAGAGG + Intergenic
1200488354 Y:3792335-3792357 CTGAAACCAGGTATGAGGATTGG - Intergenic
1200821854 Y:7593887-7593909 CTGGAAGCAGTCATGAGATTTGG + Intergenic
1201056730 Y:10001090-10001112 CTGGAAGCAGTCATGAGATTTGG - Intergenic
1201261821 Y:12165976-12165998 CTAGAACCACTAATGAGAATGGG + Intergenic
1202103928 Y:21341471-21341493 CTGGAAGCAGTCATGAGATTTGG + Intergenic
1202238449 Y:22740137-22740159 CTGGAAGCAGTCATGAGATTTGG - Intergenic