ID: 1004734270

View in Genome Browser
Species Human (GRCh38)
Location 6:18389214-18389236
Sequence TTGGCAATTTAAAGGCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004734267_1004734270 3 Left 1004734267 6:18389188-18389210 CCATTCTCATGAATGGTTTCAGT 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1004734270 6:18389214-18389236 TTGGCAATTTAAAGGCATTCAGG No data
1004734266_1004734270 4 Left 1004734266 6:18389187-18389209 CCCATTCTCATGAATGGTTTCAG 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1004734270 6:18389214-18389236 TTGGCAATTTAAAGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004734270 Original CRISPR TTGGCAATTTAAAGGCATTC AGG Intronic
No off target data available for this crispr