ID: 1004739391

View in Genome Browser
Species Human (GRCh38)
Location 6:18443204-18443226
Sequence CATTTTATGAAAAACGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004739388_1004739391 -4 Left 1004739388 6:18443185-18443207 CCTTTTGATTTAACCTCCTCATT 0: 1
1: 0
2: 4
3: 34
4: 354
Right 1004739391 6:18443204-18443226 CATTTTATGAAAAACGTAACAGG 0: 1
1: 0
2: 1
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004739391 Original CRISPR CATTTTATGAAAAACGTAAC AGG Intronic
901273048 1:7968449-7968471 AACTTTATGAAAAATGTAACGGG - Intronic
904943842 1:34184544-34184566 CATTTTTTGAAAAACAGAAGTGG + Intronic
906077940 1:43065896-43065918 TATTTTATGAAAAAAGAAAGGGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907886812 1:58599485-58599507 CATTTTAGGGAAAAAGGAACAGG - Intergenic
908262183 1:62347831-62347853 CATTTTCTGAAAATCCAAACAGG - Intergenic
908935988 1:69376109-69376131 CATTTTATAAATAAGGAAACTGG + Intergenic
909366307 1:74827066-74827088 TATTGTATGAAAAATGAAACAGG + Intergenic
910407771 1:86908430-86908452 CATTTTATAAAGAAAGAAACAGG + Intronic
911185480 1:94899900-94899922 CATTTTATGTAAAACATTCCTGG - Intronic
912267853 1:108176851-108176873 TATTTTATAAGAAACGTAAAAGG + Intronic
913313967 1:117534436-117534458 TATTTTCTGTAAAACGGAACTGG + Intergenic
914420050 1:147520868-147520890 CATTTTGAGACAAAGGTAACTGG - Intergenic
916031693 1:160882416-160882438 AACTTTATGAAAAATGTCACTGG - Intronic
916671167 1:167021871-167021893 CAATTTCTGAAAACAGTAACAGG + Exonic
917081623 1:171261710-171261732 CTTTTTATGGAGAACGGAACGGG - Intronic
917245924 1:173000235-173000257 CATTTTATGAATAATGTCATTGG + Intergenic
919099427 1:193075723-193075745 CATTATATGATCAACATAACTGG - Intronic
921186566 1:212675399-212675421 CAGTTTAAGAAAAACATTACAGG + Intergenic
921231076 1:213071899-213071921 AATTTTAAGCAAAACATAACAGG - Intronic
921339479 1:214120385-214120407 CATTTTAAGAAAAACGTACAGGG + Intergenic
921389200 1:214602725-214602747 CATTTTATTAAAAAGTTAACAGG - Intergenic
921717565 1:218433852-218433874 CATGTTATGATAAAGGTGACAGG - Intronic
923807979 1:237281373-237281395 CATCTTATGAGAAACATAATGGG - Intronic
923874333 1:238031359-238031381 CATTTTGTGAAAAATGTCATTGG - Intergenic
923928462 1:238663694-238663716 CATTTTATGAATAAAGCAATTGG - Intergenic
1063312337 10:4965629-4965651 CATTTTTTGGAAAAATTAACAGG - Intronic
1063932763 10:11045742-11045764 CATTTGTTGAAAAAGGGAACGGG + Intronic
1064395645 10:14979988-14980010 AATATTATGAATAACATAACAGG - Intronic
1065539362 10:26745506-26745528 CATCTTAACAAAAAGGTAACAGG + Intronic
1066212864 10:33257011-33257033 CTTATTATGATAAACATAACAGG + Intronic
1066361048 10:34731514-34731536 CATTTTATGAGAAACTTTATAGG - Intronic
1066686384 10:37985684-37985706 CATTTTATGAAAACCATAGTTGG + Intergenic
1067930020 10:50551330-50551352 CATTCTATGAAACACCTGACTGG + Intronic
1068029956 10:51693792-51693814 TATTTTATGAGAAAGGTAATTGG + Intronic
1068045100 10:51876596-51876618 CGTTTGCTGAACAACGTAACTGG - Intronic
1068231867 10:54178129-54178151 CCTTTTATGAAAAACTTCCCTGG - Intronic
1068484100 10:57634384-57634406 CAGTTCATGAACAACATAACAGG + Intergenic
1075641250 10:124066113-124066135 CATTTTATTAGATAGGTAACTGG - Intronic
1075866239 10:125721779-125721801 CATTTAATGAAAAACTCCACAGG - Intronic
1075868237 10:125746523-125746545 CATTTTTTAAAAAAAGTAAATGG + Intronic
1079171398 11:18099345-18099367 TATTTTCTGAAAAACCTAATAGG + Intronic
1080077744 11:28171458-28171480 TAATTTTTTAAAAACGTAACTGG + Intronic
1080618262 11:33964511-33964533 CATTTTATGAAAAACAGAAATGG + Intergenic
1080833495 11:35918349-35918371 CTTTTCATGATAAACGTAAAGGG + Intergenic
1080961855 11:37169814-37169836 CCTTTTATGAACAAAGAAACTGG - Intergenic
1082937251 11:58667937-58667959 AATATTATGAATAATGTAACAGG + Intronic
1083138230 11:60700140-60700162 CATTTTCTGGAAAAGGAAACAGG - Intronic
1085063229 11:73468063-73468085 CATTTTTTAAAAAAATTAACAGG + Intronic
1085210880 11:74777167-74777189 CATTTTATGAATGAAGAAACAGG + Intronic
1085497113 11:76979832-76979854 CATTTTATTAAAAAAAAAACAGG + Intronic
1087070851 11:94078914-94078936 GAATTTATGAATAACTTAACTGG - Intronic
1087087141 11:94231311-94231333 CATTCTATGAAAGATGCAACTGG - Intergenic
1088196867 11:107283997-107284019 CAATTTTTGTAAAACATAACCGG - Intergenic
1089573452 11:119424634-119424656 CATTTTATGAAAAATGCAGCTGG + Intronic
1090772946 11:129937873-129937895 CATTTTCTGAAAAAGAAAACAGG - Intronic
1090882986 11:130850610-130850632 CATTTTAAGAACAACCAAACAGG - Intergenic
1093399564 12:18728323-18728345 CATTTTATTAAAAACATATAAGG - Intronic
1093644204 12:21564829-21564851 CATTTTACAAATAACGAAACTGG + Intronic
1095366902 12:41418334-41418356 CATTATCTGAAAAGCATAACTGG + Intronic
1095697000 12:45154826-45154848 GATATTATGAAAAACATCACCGG - Intergenic
1095992790 12:48048899-48048921 CATTTTATCAAAAATGAAAGGGG + Intronic
1096506765 12:52098640-52098662 GATATTAGGAAAAATGTAACCGG + Intergenic
1096508761 12:52115199-52115221 GATATTAGGAAAAATGTAACCGG - Intergenic
1097832239 12:64237721-64237743 CATTTTATAAATAAAGAAACTGG + Intergenic
1099634953 12:85201712-85201734 CATTTTATGAAAACATTAATAGG - Intronic
1100623269 12:96302050-96302072 TGTTTTATGAAAAACGTCATAGG - Intronic
1101120607 12:101575670-101575692 CATCTTATGAAGAACAAAACAGG - Intronic
1104143392 12:126009425-126009447 TATTTTAGGAAAAACATAAGTGG + Intergenic
1106610756 13:31277966-31277988 CATATTATGAAAAAAGTAAAAGG - Intronic
1106937031 13:34734441-34734463 CATTTTAAGCAAAACTTGACTGG + Intergenic
1107050127 13:36038145-36038167 CATTTTATGAACAAGGAAGCTGG + Intronic
1109480061 13:62940630-62940652 CAATTTTTAAAAAACGTAATTGG - Intergenic
1110005726 13:70265281-70265303 CATTTTACAAAAAAAGAAACTGG - Intergenic
1110624688 13:77639651-77639673 CATTTTATTAAAAAAGAAACAGG - Intronic
1111230433 13:85339011-85339033 CATTTTTAGAAAAGAGTAACTGG - Intergenic
1113993966 14:16052149-16052171 AAATTTATAAAAAACGTAGCTGG - Intergenic
1114689225 14:24564582-24564604 CATTTTCAGAAGAACATAACGGG + Intergenic
1114777887 14:25505779-25505801 CATTTTATAAATAAGGAAACTGG + Intergenic
1116519946 14:45835017-45835039 GATATTATGAAAAATATAACGGG + Intergenic
1116667298 14:47794592-47794614 AATTTTTTGAAAGACGTAATTGG + Intergenic
1117022994 14:51590930-51590952 CATTTGAAGAAAAAGGCAACAGG - Intronic
1118735199 14:68696112-68696134 CATTTTATCAAAGAGGAAACAGG - Intronic
1119044181 14:71302937-71302959 CATTTTAAGAATAAAGAAACTGG - Intergenic
1119620429 14:76127633-76127655 CACTTTATGGAAAAAGAAACTGG - Intergenic
1120019509 14:79512334-79512356 CATTTTATGGATAAGGAAACAGG - Intronic
1120237399 14:81908280-81908302 CAATTTATCAGAAAAGTAACAGG + Intergenic
1121652312 14:95567746-95567768 CAATTTATGAAAAAAGCAGCCGG - Intergenic
1122750058 14:103926846-103926868 TATTTTTTGAAAAACATGACTGG + Intronic
1123139697 14:106062896-106062918 CATTTTTTAAAAAATGTAATAGG - Intergenic
1202879069 14_KI270722v1_random:40464-40486 AATTTTGTGAAAAACGACACTGG + Intergenic
1125023746 15:35010058-35010080 CATTTAAAAAAAAACGTAAAAGG - Intergenic
1126207247 15:46059679-46059701 CAATTTATGAATAACATAAATGG - Intergenic
1126207815 15:46065900-46065922 TATTTTTTGAAAAACGTAATTGG - Intergenic
1126734958 15:51721673-51721695 CGTTTTATGAAACAGGAAACTGG + Intergenic
1127159606 15:56167500-56167522 CTAATTATGAAAAATGTAACTGG + Intronic
1129133970 15:73529554-73529576 CATGTTATGAAAATTGTGACTGG + Intronic
1131922718 15:97347543-97347565 CATTTTAGGAATAAAGAAACTGG + Intergenic
1132912793 16:2324119-2324141 CATTTTATGAAAGATATTACTGG - Intronic
1132913054 16:2325648-2325670 CATTTTATGAAAGACATTACTGG - Intronic
1133618871 16:7507050-7507072 TATTTTATGAATAAGGAAACTGG + Intronic
1137345662 16:47656325-47656347 CATTTTTTAAAAAATGTAAATGG + Intronic
1139144899 16:64311544-64311566 CATACTATGAAAAACATAAAGGG + Intergenic
1139288555 16:65836886-65836908 CATTTTATTAAAGAAGTTACTGG - Intergenic
1142299828 16:89250142-89250164 CATTTTATGAATATTGAAACTGG + Intergenic
1143418469 17:6769450-6769472 CATCTCATGAAAAACAGAACAGG - Intronic
1143806861 17:9436067-9436089 CATTTTAAGAAAAACATTTCAGG - Intronic
1147525987 17:41223816-41223838 CATCTTATGAAAAAGGAAAAAGG + Intronic
1147876755 17:43627236-43627258 CATTTTATGAATAAAGAAACTGG + Intergenic
1150459772 17:65339787-65339809 CATTTTATAAATAAAGTAACAGG - Intergenic
1150795143 17:68230677-68230699 CATTTTATTAAGAAGGGAACAGG + Intergenic
1152186391 17:78859044-78859066 TATTTTGTGAAAAACAAAACAGG - Intronic
1153003435 18:476712-476734 CTTTTAATGAAACAGGTAACTGG + Intronic
1153362679 18:4215092-4215114 CATATTATGAAAAGGGAAACTGG - Intronic
1156076989 18:33290891-33290913 TATATTATAAAAAAAGTAACTGG + Intronic
1156102630 18:33616326-33616348 CATATCATGAAAAAAATAACGGG - Intronic
1159061275 18:63517202-63517224 CATTTTATGATTAACGAAATTGG - Intergenic
1162912585 19:13856856-13856878 CATTTTTTTAAAAAAGTAGCAGG + Intergenic
1163814478 19:19455848-19455870 CATTTTAAGAAAAAGTTTACTGG + Intronic
1164848388 19:31456233-31456255 CAATGTATGAAAAAAGTTACAGG + Intergenic
1165929775 19:39349662-39349684 CACTTCATGAACAAGGTAACAGG - Intronic
1168595352 19:57671182-57671204 CATTATATGAAATATGTAGCTGG + Intronic
1202654690 1_KI270708v1_random:9472-9494 AATTTTGTGAAAAACGACACTGG + Intergenic
925477417 2:4233052-4233074 CATTTTTTAAAAAACTTAAAAGG - Intergenic
925785110 2:7424246-7424268 CTTTTTATAAAAGACGTAAGGGG - Intergenic
927935450 2:27073354-27073376 CATCTTATGAAGAAAGAAACTGG + Intergenic
928923418 2:36550852-36550874 CATATTATGAAAATACTAACAGG + Exonic
930520501 2:52460177-52460199 CATCTTATAGAAAACTTAACTGG + Intergenic
931536720 2:63285670-63285692 CATTTCATGAAAAAGGTCAATGG + Intronic
931854659 2:66289661-66289683 AATTTTGTAAAAAATGTAACAGG - Intergenic
932353704 2:71051406-71051428 GATATTAGGAAAAATGTAACTGG + Intergenic
932721707 2:74143457-74143479 CATTATAAGAAAAACAGAACAGG - Intronic
933396252 2:81735132-81735154 CATTTTATGAAAAAAGTTCAGGG + Intergenic
933782991 2:85814643-85814665 CATTTTATGCAAAATATAACAGG + Intergenic
934673519 2:96232497-96232519 CATTTTCTGAATAACTTAAAAGG - Intergenic
934953511 2:98596115-98596137 CATTTTAGGAAAAAAAGAACTGG + Intergenic
935194579 2:100804887-100804909 CATTTTATGAAAAAAATAAAAGG + Intergenic
936698210 2:114976505-114976527 CATTTGAGGAAAAAGGCAACAGG - Intronic
937558293 2:123187707-123187729 CATTATATGCAAAAAGGAACAGG - Intergenic
937616345 2:123926797-123926819 CATAGTATGAGAAATGTAACTGG + Intergenic
937657570 2:124393986-124394008 TATTTTATATAAAATGTAACTGG - Intronic
940202634 2:151168075-151168097 CATTTTAGGAAAAAAATAATGGG + Intergenic
940911156 2:159211169-159211191 CATTTTAAGAACAACCTGACTGG - Intronic
941812023 2:169764574-169764596 GATTTTTTTAAAAACCTAACCGG - Intronic
942809143 2:179975871-179975893 ATTTCTGTGAAAAACGTAACTGG - Intronic
943787699 2:191896975-191896997 CATTTTATCTAAAATGTACCAGG + Intergenic
944972493 2:205009828-205009850 CACTTTTTAAAAAACTTAACAGG - Intronic
945562778 2:211358901-211358923 AATTTTATGAATGAGGTAACAGG + Intergenic
946739322 2:222786322-222786344 CATTTTATGACTAAACTAACAGG + Intergenic
1172619849 20:36311706-36311728 CATTTTATGGAAGAGGAAACTGG + Intronic
1174363723 20:50043939-50043961 CATTTTAAGAAAGAGGGAACTGG + Intergenic
1176864906 21:14042528-14042550 CATTTAATTAAAAAATTAACAGG + Intergenic
1177229016 21:18294896-18294918 CATTTTATGGAAGAAGAAACTGG - Intronic
1179671813 21:42954607-42954629 GATATTAGGAAAAATGTAACTGG - Intergenic
1180313302 22:11255366-11255388 AAATTTATAAAAAACGTAGCTGG + Intergenic
1180388811 22:12204923-12204945 AATTTTGTGAAAAACGACACTGG - Intergenic
1184806931 22:46801310-46801332 CATTACATGAAAGACGTAAGTGG + Intronic
949774728 3:7619922-7619944 AATTTTAAGAAAAACGTCATTGG - Intronic
951465429 3:22996202-22996224 CATTATATGAAAAACATACATGG + Intergenic
951924403 3:27891776-27891798 CATTTCCTTAAAAAAGTAACAGG + Intergenic
952606489 3:35153548-35153570 CATTCTGTGAAGAATGTAACTGG + Intergenic
952621960 3:35355611-35355633 CAATTTATGAAAAAAGAAATTGG + Intergenic
955388700 3:58501846-58501868 CTTTTTATAAAAAAGGTATCTGG - Exonic
959363959 3:105432890-105432912 CATATTCTGTGAAACGTAACAGG + Intronic
959982338 3:112529681-112529703 GATATTAGGAAAAATGTAACTGG - Intergenic
960728723 3:120700103-120700125 GATTTTATGAAAAAGTTAAAAGG - Intronic
961277151 3:125736788-125736810 GATTTTATGAAAAATATCACAGG + Intergenic
961590933 3:127981301-127981323 CATTTTGTAGAAAAGGTAACAGG - Intronic
963979441 3:151520429-151520451 CCTCTTATGAAAAATGTCACTGG + Intergenic
964824710 3:160812370-160812392 CATTTTATGAAGAAAGAAAAAGG - Intronic
966462578 3:180193688-180193710 GATTTTTTGAAAAATGTATCAGG - Intergenic
967414635 3:189202517-189202539 CCTTTTAGGCAAAACGTAATAGG + Intronic
967510370 3:190304220-190304242 CATTTTATGAATGAAGAAACTGG + Intergenic
968683214 4:1936308-1936330 CAGTTCATGAAAAAGTTAACCGG - Intronic
968892422 4:3376653-3376675 CATTTTTTGAAAAATGAAATGGG - Intronic
970224386 4:13842387-13842409 CAGCTTATGAAAAAGGTATCAGG + Intergenic
971079514 4:23193692-23193714 CACTTTTTCAAAAACGTGACAGG + Intergenic
971772937 4:30922562-30922584 CATGTCATGGAAAACTTAACAGG + Intronic
973302618 4:48605062-48605084 CATTTTATAAAAAAGAAAACAGG - Intronic
973318011 4:48781113-48781135 AATTTTTTCAAAAAAGTAACAGG - Intergenic
974255247 4:59444746-59444768 AATTTGATGAAAAAAGCAACAGG + Intergenic
978141774 4:105326084-105326106 CATTTCATGAAGAACGTCATAGG - Intergenic
978211408 4:106141446-106141468 CATTTTATGAACAAGGAAACAGG + Intronic
980348073 4:131650470-131650492 CATTTTATGTACAAAGTTACTGG - Intergenic
980447245 4:132926131-132926153 CATTTAATGAAAAACTAAAGGGG - Intergenic
981743004 4:148022745-148022767 CATTTTATGAAAAATGTAAATGG + Intronic
981893553 4:149768630-149768652 CATTACATGAAAAATGTCACAGG - Intergenic
981930373 4:150183067-150183089 CATTTTATAGAAGACGTAATGGG - Intronic
982787583 4:159554219-159554241 CACTTTTAGAAAAATGTAACAGG - Intergenic
982840320 4:160175717-160175739 CATTTTAAGAAAAAAGCAAACGG + Intergenic
983380582 4:166987082-166987104 AATTTTATCATAAATGTAACTGG - Intronic
983482923 4:168297618-168297640 CATCTTATCAAAAACAAAACTGG + Intronic
984010506 4:174365861-174365883 AACTTTATGAAAAATGCAACAGG - Intergenic
984334156 4:178366064-178366086 CTTTTTGGGAAAAATGTAACGGG + Intergenic
984575294 4:181440826-181440848 CATTTTACAGAAGACGTAACTGG - Intergenic
984581331 4:181513412-181513434 AATTTTCTTAAAAATGTAACCGG + Intergenic
984636481 4:182115871-182115893 TAATTTTTAAAAAACGTAACTGG - Intergenic
986350723 5:6877209-6877231 CATTTGATTAAAAACGAAAATGG - Intergenic
986876794 5:12121402-12121424 CATTTACAGAAAAATGTAACGGG - Intergenic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
988548757 5:32181574-32181596 CATTTTATGAAAAGAGAAACAGG + Intergenic
990296208 5:54404139-54404161 AGTTTTATGAAAAGCTTAACTGG - Intergenic
990898101 5:60721170-60721192 AATTTTATGAAAAATGTCATTGG - Intergenic
991010590 5:61879077-61879099 CATTTTATGAAGGAGGAAACAGG + Intergenic
991078104 5:62564934-62564956 CATTTTAAGAACAAGGAAACAGG - Intronic
992056471 5:72996262-72996284 CATTATATGAAATACATAACAGG - Intronic
992303919 5:75415196-75415218 CATTCCATGTAAAATGTAACTGG + Intronic
993057270 5:82996347-82996369 CATTTTATGAAATATGCATCTGG + Intergenic
993321816 5:86479197-86479219 CATCTTAAGAAAAAAGCAACAGG + Intergenic
994391363 5:99196659-99196681 GATTTTATGAAAAATATCACAGG + Intergenic
995437252 5:112150722-112150744 CATTTTATGGAAAAAGTCACAGG - Intronic
996056157 5:118984920-118984942 TATTTTATAAAAAAAGCAACTGG - Intronic
996153270 5:120066119-120066141 CAGTTTTTGAAAAAAGAAACTGG + Intergenic
996155707 5:120096718-120096740 CACTTTATGATAAACAAAACGGG + Intergenic
997559856 5:134836840-134836862 CATATTATAAAAAACTTAACAGG - Intronic
998665601 5:144293778-144293800 CATTATATGCAAAATGTAACTGG - Intronic
998705780 5:144758443-144758465 CATTTTATTAAAAAGATAATTGG + Intergenic
998721006 5:144948956-144948978 CGTTTTATGAAAAACTGATCTGG - Intergenic
999139965 5:149353910-149353932 CATTTTACGAATAAAGAAACAGG - Exonic
999537956 5:152539110-152539132 CACTTTATGAAACAAATAACTGG - Intergenic
1000385062 5:160667346-160667368 CATTTTATACAAAACGAAACTGG - Intronic
1002353138 5:178599424-178599446 CTTTACTTGAAAAACGTAACAGG + Intergenic
1004066694 6:12253137-12253159 CATTTTATGAAAATCTTGGCAGG - Intergenic
1004739391 6:18443204-18443226 CATTTTATGAAAAACGTAACAGG + Intronic
1005248760 6:23919507-23919529 CATATTATGATAAATTTAACTGG + Intergenic
1009046362 6:58241245-58241267 GATATTAGGAACAACGTAACGGG - Intergenic
1009828783 6:68902532-68902554 GATTTAAAGAAAAACTTAACAGG + Intronic
1010973222 6:82284691-82284713 CATTTTCTGAAAAACAGAATGGG - Intergenic
1011988384 6:93480048-93480070 CATTTTATCAAAAACCAAAATGG + Intergenic
1012801812 6:103839818-103839840 CATTTTTTAAAAAAAGTAATAGG - Intergenic
1013189842 6:107792866-107792888 CATTTTATCAAAAAGCTAATGGG + Intronic
1013764975 6:113564346-113564368 CATTTAATTAAACACATAACAGG - Intergenic
1016549713 6:145265405-145265427 CATATTCTGGAAAATGTAACTGG + Intergenic
1016855148 6:148661549-148661571 CCTTTTTTGAAAAACAGAACTGG - Intergenic
1017589460 6:155962710-155962732 TGTTTTATGAAAAAGGTAAAGGG + Intergenic
1021812338 7:24415154-24415176 CATTTTATAGATAACGGAACTGG + Intergenic
1023664993 7:42513683-42513705 CATTTTATGAGAAAAGTCATAGG - Intergenic
1024814214 7:53249024-53249046 CAATTTATTAAAGATGTAACAGG + Intergenic
1024940714 7:54760083-54760105 CATTTACTAAAAAACTTAACAGG - Intergenic
1027508340 7:79046905-79046927 CATTTCATGAAACACATAATTGG - Intronic
1031673276 7:124578400-124578422 CATTATATGACAAAAGTAAAGGG + Intergenic
1034247202 7:149655852-149655874 CATTTTACAAAAAACTTACCTGG + Intergenic
1036061332 8:5324710-5324732 CAGTGTATGAAAAATGTTACAGG - Intergenic
1036240082 8:7074007-7074029 GATATTAGGAAAAATGTAACTGG + Intergenic
1039039138 8:33390335-33390357 CATTTTACGAAAAAGGAAACAGG + Intronic
1040061794 8:43110421-43110443 CATTTTATGAAGTATTTAACAGG + Intronic
1042034880 8:64521869-64521891 CATTTTATTAAAAAAATAAAAGG - Intergenic
1042765745 8:72320189-72320211 CATTTTCTTTAAAACGTTACTGG + Intergenic
1043038950 8:75235220-75235242 CAATTTATGAATGACTTAACTGG + Intergenic
1043172909 8:76987497-76987519 TATTTTATGAGGAAGGTAACGGG + Intronic
1043240878 8:77934155-77934177 CATTTTATTAGAAAAGTTACTGG - Intergenic
1043618946 8:82163933-82163955 CATTTTTTGAAAAAATTAATTGG + Intergenic
1043635756 8:82379144-82379166 AATATTATGAACAATGTAACAGG - Intergenic
1043664803 8:82795588-82795610 GATTTTATGAACAAAGTAAAAGG - Intergenic
1044998234 8:97857544-97857566 CAGTTTTTAAAAAACGCAACAGG + Intergenic
1046739891 8:117816672-117816694 CATTTTATAAAGAAAGAAACGGG + Intronic
1051148155 9:14051717-14051739 CATTTTATGAAAAACCATGCTGG + Intergenic
1051886108 9:21895142-21895164 AATTCTATGAAAAACGTCATTGG - Intronic
1058630509 9:106981841-106981863 CATTATATGAAAAATGATACCGG + Intronic
1059702443 9:116788593-116788615 CATTTTATAAATGAGGTAACTGG - Intronic
1059972258 9:119679820-119679842 CATTTTATAAATAAAGAAACTGG - Intergenic
1060066044 9:120501961-120501983 CATTTTATGAATGAGGAAACAGG + Intronic
1060192749 9:121603435-121603457 CATTTTATGAAAGAGGTCACTGG + Intronic
1061105498 9:128527013-128527035 CATTTTATAGAAAAGGAAACAGG - Intronic
1061774861 9:132955156-132955178 CATTTTATAAAAAATGTTAAAGG - Intronic
1186080853 X:5930242-5930264 TATTTTATGAAAAGAGTAACTGG + Intronic
1186757909 X:12692181-12692203 CATTTTAAAAGAAATGTAACTGG - Intronic
1187008760 X:15258154-15258176 CATTTTATGAAAGCAGAAACCGG + Intronic
1187309142 X:18123906-18123928 CATGTTATGAAAATAGTCACTGG + Intergenic
1188337463 X:28955181-28955203 CATTTTATCAAACACGTGACAGG + Intronic
1188717731 X:33481062-33481084 AATTCTATGAAAAAGGTTACTGG - Intergenic
1188997215 X:36900209-36900231 CATTTTTTGAAGAATGCAACTGG + Intergenic
1190011941 X:46792725-46792747 TATTTTATGACTAACGCAACTGG - Intergenic
1191120852 X:56902927-56902949 CATTTTATGAAAAATTTAGGAGG - Intergenic
1192075888 X:67996076-67996098 AATTTTGTGAAAAACGTCATTGG + Intergenic
1194969346 X:100325743-100325765 CATTCCATGAACAATGTAACTGG - Intronic
1196527535 X:116744105-116744127 CATTTTATGAAAAATGACATTGG + Intergenic
1198868129 X:141147475-141147497 CATTTTAAGAAAAAACAAACTGG - Intergenic
1199616644 X:149661083-149661105 CATTTGCTGAAACAAGTAACAGG + Intergenic
1199625997 X:149742165-149742187 CATTTGCTGAAACAAGTAACAGG - Intergenic