ID: 1004743980

View in Genome Browser
Species Human (GRCh38)
Location 6:18491673-18491695
Sequence TGAGCCCCTGTGGAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004743980_1004743990 19 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743980_1004743987 6 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743987 6:18491702-18491724 CACGCCTCTAAAGGCCTGAACGG No data
1004743980_1004743989 18 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743989 6:18491714-18491736 GGCCTGAACGGAAAGAATTGTGG No data
1004743980_1004743992 22 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743992 6:18491718-18491740 TGAACGGAAAGAATTGTGGGTGG No data
1004743980_1004743993 23 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743980_1004743986 -3 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743986 6:18491693-18491715 TCAGCTCAGCACGCCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004743980 Original CRISPR TGAGCCCCTGTGGAGGGGGA TGG (reversed) Intergenic