ID: 1004743981

View in Genome Browser
Species Human (GRCh38)
Location 6:18491677-18491699
Sequence GAGCTGAGCCCCTGTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004743981_1004743989 14 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743989 6:18491714-18491736 GGCCTGAACGGAAAGAATTGTGG No data
1004743981_1004743990 15 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743981_1004743992 18 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743992 6:18491718-18491740 TGAACGGAAAGAATTGTGGGTGG No data
1004743981_1004743986 -7 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743986 6:18491693-18491715 TCAGCTCAGCACGCCTCTAAAGG No data
1004743981_1004743994 28 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743994 6:18491728-18491750 GAATTGTGGGTGGGAGCCAAAGG No data
1004743981_1004743993 19 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743981_1004743987 2 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743987 6:18491702-18491724 CACGCCTCTAAAGGCCTGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004743981 Original CRISPR GAGCTGAGCCCCTGTGGAGG GGG (reversed) Intergenic