ID: 1004743985

View in Genome Browser
Species Human (GRCh38)
Location 6:18491683-18491705
Sequence CGTGCTGAGCTGAGCCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004743985_1004743994 22 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743994 6:18491728-18491750 GAATTGTGGGTGGGAGCCAAAGG No data
1004743985_1004743989 8 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743989 6:18491714-18491736 GGCCTGAACGGAAAGAATTGTGG No data
1004743985_1004743993 13 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743985_1004743990 9 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743985_1004743987 -4 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743987 6:18491702-18491724 CACGCCTCTAAAGGCCTGAACGG No data
1004743985_1004743992 12 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743992 6:18491718-18491740 TGAACGGAAAGAATTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004743985 Original CRISPR CGTGCTGAGCTGAGCCCCTG TGG (reversed) Intergenic
No off target data available for this crispr