ID: 1004743990

View in Genome Browser
Species Human (GRCh38)
Location 6:18491715-18491737
Sequence GCCTGAACGGAAAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004743985_1004743990 9 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743983_1004743990 13 Left 1004743983 6:18491679-18491701 CCCTCCACAGGGGCTCAGCTCAG No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743980_1004743990 19 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743982_1004743990 14 Left 1004743982 6:18491678-18491700 CCCCTCCACAGGGGCTCAGCTCA No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743984_1004743990 12 Left 1004743984 6:18491680-18491702 CCTCCACAGGGGCTCAGCTCAGC No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data
1004743981_1004743990 15 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743990 6:18491715-18491737 GCCTGAACGGAAAGAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004743990 Original CRISPR GCCTGAACGGAAAGAATTGT GGG Intergenic
No off target data available for this crispr