ID: 1004743993

View in Genome Browser
Species Human (GRCh38)
Location 6:18491719-18491741
Sequence GAACGGAAAGAATTGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004743988_1004743993 -10 Left 1004743988 6:18491706-18491728 CCTCTAAAGGCCTGAACGGAAAG No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743980_1004743993 23 Left 1004743980 6:18491673-18491695 CCATCCCCCTCCACAGGGGCTCA No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743983_1004743993 17 Left 1004743983 6:18491679-18491701 CCCTCCACAGGGGCTCAGCTCAG No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743981_1004743993 19 Left 1004743981 6:18491677-18491699 CCCCCTCCACAGGGGCTCAGCTC No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743985_1004743993 13 Left 1004743985 6:18491683-18491705 CCACAGGGGCTCAGCTCAGCACG No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743982_1004743993 18 Left 1004743982 6:18491678-18491700 CCCCTCCACAGGGGCTCAGCTCA No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data
1004743984_1004743993 16 Left 1004743984 6:18491680-18491702 CCTCCACAGGGGCTCAGCTCAGC No data
Right 1004743993 6:18491719-18491741 GAACGGAAAGAATTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004743993 Original CRISPR GAACGGAAAGAATTGTGGGT GGG Intergenic
No off target data available for this crispr