ID: 1004745060

View in Genome Browser
Species Human (GRCh38)
Location 6:18501516-18501538
Sequence GGCACCAGGGGGGCTTCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745060_1004745068 -10 Left 1004745060 6:18501516-18501538 CCCCGCGAAGCCCCCCTGGTGCC No data
Right 1004745068 6:18501529-18501551 CCCTGGTGCCCCATGAGGAATGG No data
1004745060_1004745075 30 Left 1004745060 6:18501516-18501538 CCCCGCGAAGCCCCCCTGGTGCC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745060 Original CRISPR GGCACCAGGGGGGCTTCGCG GGG (reversed) Intergenic
No off target data available for this crispr