ID: 1004745062 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:18501518-18501540 |
Sequence | GGGGCACCAGGGGGGCTTCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1004745062_1004745075 | 28 | Left | 1004745062 | 6:18501518-18501540 | CCGCGAAGCCCCCCTGGTGCCCC | No data | ||
Right | 1004745075 | 6:18501569-18501591 | TTTCAATTCCTCTCCATCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1004745062 | Original CRISPR | GGGGCACCAGGGGGGCTTCG CGG (reversed) | Intergenic | ||