ID: 1004745062

View in Genome Browser
Species Human (GRCh38)
Location 6:18501518-18501540
Sequence GGGGCACCAGGGGGGCTTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745062_1004745075 28 Left 1004745062 6:18501518-18501540 CCGCGAAGCCCCCCTGGTGCCCC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745062 Original CRISPR GGGGCACCAGGGGGGCTTCG CGG (reversed) Intergenic
No off target data available for this crispr