ID: 1004745064

View in Genome Browser
Species Human (GRCh38)
Location 6:18501526-18501548
Sequence TTCCTCATGGGGCACCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745064_1004745075 20 Left 1004745064 6:18501526-18501548 CCCCCCTGGTGCCCCATGAGGAA No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745064 Original CRISPR TTCCTCATGGGGCACCAGGG GGG (reversed) Intergenic
No off target data available for this crispr