ID: 1004745067

View in Genome Browser
Species Human (GRCh38)
Location 6:18501529-18501551
Sequence CCATTCCTCATGGGGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745067_1004745075 17 Left 1004745067 6:18501529-18501551 CCCTGGTGCCCCATGAGGAATGG No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745067_1004745077 29 Left 1004745067 6:18501529-18501551 CCCTGGTGCCCCATGAGGAATGG No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745067 Original CRISPR CCATTCCTCATGGGGCACCA GGG (reversed) Intergenic