ID: 1004745072

View in Genome Browser
Species Human (GRCh38)
Location 6:18501539-18501561
Sequence CTGAGAAGGGCCATTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745072_1004745077 19 Left 1004745072 6:18501539-18501561 CCATGAGGAATGGCCCTTCTCAG No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745072_1004745075 7 Left 1004745072 6:18501539-18501561 CCATGAGGAATGGCCCTTCTCAG No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745072 Original CRISPR CTGAGAAGGGCCATTCCTCA TGG (reversed) Intergenic
No off target data available for this crispr