ID: 1004745074

View in Genome Browser
Species Human (GRCh38)
Location 6:18501553-18501575
Sequence ATTGAAAAGAGCTACTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745074_1004745075 -7 Left 1004745074 6:18501553-18501575 CCTTCTCAGTAGCTCTTTTCAAT No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745074_1004745077 5 Left 1004745074 6:18501553-18501575 CCTTCTCAGTAGCTCTTTTCAAT No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745074 Original CRISPR ATTGAAAAGAGCTACTGAGA AGG (reversed) Intergenic
No off target data available for this crispr