ID: 1004745075

View in Genome Browser
Species Human (GRCh38)
Location 6:18501569-18501591
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745067_1004745075 17 Left 1004745067 6:18501529-18501551 CCCTGGTGCCCCATGAGGAATGG No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745062_1004745075 28 Left 1004745062 6:18501518-18501540 CCGCGAAGCCCCCCTGGTGCCCC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745069_1004745075 16 Left 1004745069 6:18501530-18501552 CCTGGTGCCCCATGAGGAATGGC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745072_1004745075 7 Left 1004745072 6:18501539-18501561 CCATGAGGAATGGCCCTTCTCAG No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745071_1004745075 8 Left 1004745071 6:18501538-18501560 CCCATGAGGAATGGCCCTTCTCA No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745065_1004745075 19 Left 1004745065 6:18501527-18501549 CCCCCTGGTGCCCCATGAGGAAT No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745074_1004745075 -7 Left 1004745074 6:18501553-18501575 CCTTCTCAGTAGCTCTTTTCAAT No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745070_1004745075 9 Left 1004745070 6:18501537-18501559 CCCCATGAGGAATGGCCCTTCTC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745061_1004745075 29 Left 1004745061 6:18501517-18501539 CCCGCGAAGCCCCCCTGGTGCCC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745066_1004745075 18 Left 1004745066 6:18501528-18501550 CCCCTGGTGCCCCATGAGGAATG No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745073_1004745075 -6 Left 1004745073 6:18501552-18501574 CCCTTCTCAGTAGCTCTTTTCAA No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745060_1004745075 30 Left 1004745060 6:18501516-18501538 CCCCGCGAAGCCCCCCTGGTGCC No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data
1004745064_1004745075 20 Left 1004745064 6:18501526-18501548 CCCCCCTGGTGCCCCATGAGGAA No data
Right 1004745075 6:18501569-18501591 TTTCAATTCCTCTCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745075 Original CRISPR TTTCAATTCCTCTCCATCCC AGG Intergenic