ID: 1004745077

View in Genome Browser
Species Human (GRCh38)
Location 6:18501581-18501603
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004745071_1004745077 20 Left 1004745071 6:18501538-18501560 CCCATGAGGAATGGCCCTTCTCA No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745074_1004745077 5 Left 1004745074 6:18501553-18501575 CCTTCTCAGTAGCTCTTTTCAAT No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745072_1004745077 19 Left 1004745072 6:18501539-18501561 CCATGAGGAATGGCCCTTCTCAG No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745073_1004745077 6 Left 1004745073 6:18501552-18501574 CCCTTCTCAGTAGCTCTTTTCAA No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745070_1004745077 21 Left 1004745070 6:18501537-18501559 CCCCATGAGGAATGGCCCTTCTC No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745069_1004745077 28 Left 1004745069 6:18501530-18501552 CCTGGTGCCCCATGAGGAATGGC No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745066_1004745077 30 Left 1004745066 6:18501528-18501550 CCCCTGGTGCCCCATGAGGAATG No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data
1004745067_1004745077 29 Left 1004745067 6:18501529-18501551 CCCTGGTGCCCCATGAGGAATGG No data
Right 1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004745077 Original CRISPR TCCATCCCAGGTTACCTCTA CGG Intergenic