ID: 1004750261

View in Genome Browser
Species Human (GRCh38)
Location 6:18555191-18555213
Sequence GATTATATTTCTGCACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004750261_1004750264 11 Left 1004750261 6:18555191-18555213 CCTGGTGGTGCAGAAATATAATC No data
Right 1004750264 6:18555225-18555247 AGGAACAGAGAGAAATGGAAAGG No data
1004750261_1004750265 25 Left 1004750261 6:18555191-18555213 CCTGGTGGTGCAGAAATATAATC No data
Right 1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG No data
1004750261_1004750263 6 Left 1004750261 6:18555191-18555213 CCTGGTGGTGCAGAAATATAATC No data
Right 1004750263 6:18555220-18555242 GAACAAGGAACAGAGAGAAATGG No data
1004750261_1004750262 -9 Left 1004750261 6:18555191-18555213 CCTGGTGGTGCAGAAATATAATC No data
Right 1004750262 6:18555205-18555227 AATATAATCTCATTTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004750261 Original CRISPR GATTATATTTCTGCACCACC AGG (reversed) Intergenic
No off target data available for this crispr