ID: 1004750265

View in Genome Browser
Species Human (GRCh38)
Location 6:18555239-18555261
Sequence ATGGAAAGGCAGAATGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004750261_1004750265 25 Left 1004750261 6:18555191-18555213 CCTGGTGGTGCAGAAATATAATC No data
Right 1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004750265 Original CRISPR ATGGAAAGGCAGAATGACAA AGG Intergenic
No off target data available for this crispr