ID: 1004757250

View in Genome Browser
Species Human (GRCh38)
Location 6:18625093-18625115
Sequence TTCAAACATATCTCGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004757249_1004757250 9 Left 1004757249 6:18625061-18625083 CCTTAACGAATATACTAGATGAA No data
Right 1004757250 6:18625093-18625115 TTCAAACATATCTCGATTGATGG No data
1004757247_1004757250 23 Left 1004757247 6:18625047-18625069 CCACAACCTGGAAACCTTAACGA No data
Right 1004757250 6:18625093-18625115 TTCAAACATATCTCGATTGATGG No data
1004757248_1004757250 17 Left 1004757248 6:18625053-18625075 CCTGGAAACCTTAACGAATATAC No data
Right 1004757250 6:18625093-18625115 TTCAAACATATCTCGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004757250 Original CRISPR TTCAAACATATCTCGATTGA TGG Intergenic
No off target data available for this crispr