ID: 1004764918

View in Genome Browser
Species Human (GRCh38)
Location 6:18715215-18715237
Sequence GAGAGTGTCAAATGAATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004764918_1004764921 1 Left 1004764918 6:18715215-18715237 CCAGACATTCATTTGACACTCTC No data
Right 1004764921 6:18715239-18715261 TTTTCATTCCATGAGCATGGAGG No data
1004764918_1004764919 -2 Left 1004764918 6:18715215-18715237 CCAGACATTCATTTGACACTCTC No data
Right 1004764919 6:18715236-18715258 TCCTTTTCATTCCATGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004764918 Original CRISPR GAGAGTGTCAAATGAATGTC TGG (reversed) Intergenic
No off target data available for this crispr