ID: 1004769520

View in Genome Browser
Species Human (GRCh38)
Location 6:18766021-18766043
Sequence GAGCCAACACCTACCCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004769520_1004769523 8 Left 1004769520 6:18766021-18766043 CCTTGTTGGGTAGGTGTTGGCTC No data
Right 1004769523 6:18766052-18766074 AAGGAAATACTGTGAATAGAGGG No data
1004769520_1004769524 21 Left 1004769520 6:18766021-18766043 CCTTGTTGGGTAGGTGTTGGCTC No data
Right 1004769524 6:18766065-18766087 GAATAGAGGGAAATTAGAATTGG No data
1004769520_1004769522 7 Left 1004769520 6:18766021-18766043 CCTTGTTGGGTAGGTGTTGGCTC No data
Right 1004769522 6:18766051-18766073 AAAGGAAATACTGTGAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004769520 Original CRISPR GAGCCAACACCTACCCAACA AGG (reversed) Intergenic
No off target data available for this crispr