ID: 1004773192

View in Genome Browser
Species Human (GRCh38)
Location 6:18810379-18810401
Sequence CCTTCCACGTAGAACAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004773189_1004773192 -2 Left 1004773189 6:18810358-18810380 CCAGGCTTGGACATATGTGTTCC No data
Right 1004773192 6:18810379-18810401 CCTTCCACGTAGAACAGAGTGGG No data
1004773186_1004773192 25 Left 1004773186 6:18810331-18810353 CCACTGGGTCTTAATAATGATAA No data
Right 1004773192 6:18810379-18810401 CCTTCCACGTAGAACAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004773192 Original CRISPR CCTTCCACGTAGAACAGAGT GGG Intergenic
No off target data available for this crispr