ID: 1004774612

View in Genome Browser
Species Human (GRCh38)
Location 6:18829623-18829645
Sequence AGGCTGATCAATAGCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004774609_1004774612 16 Left 1004774609 6:18829584-18829606 CCATTACTTGGAATTCAATAAAG No data
Right 1004774612 6:18829623-18829645 AGGCTGATCAATAGCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004774612 Original CRISPR AGGCTGATCAATAGCACTGA AGG Intergenic
No off target data available for this crispr