ID: 1004780219

View in Genome Browser
Species Human (GRCh38)
Location 6:18900158-18900180
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004780219_1004780223 20 Left 1004780219 6:18900158-18900180 CCTTGAGGGTTCAATAGCCATGT No data
Right 1004780223 6:18900201-18900223 TTAAGAAAGTGAGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004780219 Original CRISPR ACATGGCTATTGAACCCTCA AGG (reversed) Intergenic
No off target data available for this crispr