ID: 1004790050

View in Genome Browser
Species Human (GRCh38)
Location 6:19015424-19015446
Sequence ACATTCTGTAGAATAACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004790049_1004790050 15 Left 1004790049 6:19015386-19015408 CCAGTGTGTTAATTAGGAAATAA No data
Right 1004790050 6:19015424-19015446 ACATTCTGTAGAATAACATCTGG No data
1004790048_1004790050 16 Left 1004790048 6:19015385-19015407 CCCAGTGTGTTAATTAGGAAATA No data
Right 1004790050 6:19015424-19015446 ACATTCTGTAGAATAACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004790050 Original CRISPR ACATTCTGTAGAATAACATC TGG Intergenic
No off target data available for this crispr