ID: 1004804586

View in Genome Browser
Species Human (GRCh38)
Location 6:19188749-19188771
Sequence CCGTGACAGTCTCTGTAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004804586_1004804589 2 Left 1004804586 6:19188749-19188771 CCGCATTACAGAGACTGTCACGG No data
Right 1004804589 6:19188774-19188796 TGGAATCATACCTTTAAACTTGG No data
1004804586_1004804592 16 Left 1004804586 6:19188749-19188771 CCGCATTACAGAGACTGTCACGG No data
Right 1004804592 6:19188788-19188810 TAAACTTGGCACCTAATTCTGGG No data
1004804586_1004804591 15 Left 1004804586 6:19188749-19188771 CCGCATTACAGAGACTGTCACGG No data
Right 1004804591 6:19188787-19188809 TTAAACTTGGCACCTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004804586 Original CRISPR CCGTGACAGTCTCTGTAATG CGG (reversed) Intergenic
No off target data available for this crispr