ID: 1004807296

View in Genome Browser
Species Human (GRCh38)
Location 6:19217654-19217676
Sequence CGTCCTCCCCAAAACTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004807295_1004807296 23 Left 1004807295 6:19217608-19217630 CCTCAAAGTTTTGTTTAAAGTTC No data
Right 1004807296 6:19217654-19217676 CGTCCTCCCCAAAACTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004807296 Original CRISPR CGTCCTCCCCAAAACTGCAG TGG Intergenic
No off target data available for this crispr