ID: 1004808680

View in Genome Browser
Species Human (GRCh38)
Location 6:19234161-19234183
Sequence CTTAATCTGCAGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004808672_1004808680 -6 Left 1004808672 6:19234144-19234166 CCCTATAGAACAAAAGCCTTAAT No data
Right 1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG No data
1004808670_1004808680 3 Left 1004808670 6:19234135-19234157 CCCTATTTTCCCTATAGAACAAA No data
Right 1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG No data
1004808671_1004808680 2 Left 1004808671 6:19234136-19234158 CCTATTTTCCCTATAGAACAAAA No data
Right 1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG No data
1004808669_1004808680 4 Left 1004808669 6:19234134-19234156 CCCCTATTTTCCCTATAGAACAA No data
Right 1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG No data
1004808673_1004808680 -7 Left 1004808673 6:19234145-19234167 CCTATAGAACAAAAGCCTTAATC No data
Right 1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004808680 Original CRISPR CTTAATCTGCAGAGGGAAGG GGG Intergenic
No off target data available for this crispr