ID: 1004813965

View in Genome Browser
Species Human (GRCh38)
Location 6:19292308-19292330
Sequence GACACTTTTGTTTGTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004813963_1004813965 10 Left 1004813963 6:19292275-19292297 CCTCAGTAACAAGTTTGAAATAA No data
Right 1004813965 6:19292308-19292330 GACACTTTTGTTTGTACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004813965 Original CRISPR GACACTTTTGTTTGTACAGG TGG Intergenic
No off target data available for this crispr