ID: 1004814093

View in Genome Browser
Species Human (GRCh38)
Location 6:19293886-19293908
Sequence CAGGGTGACCTGAGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004814093_1004814100 6 Left 1004814093 6:19293886-19293908 CCCACTTTCCTCAGGTCACCCTG No data
Right 1004814100 6:19293915-19293937 GATGAGAGAAGAGAAAAGGTGGG No data
1004814093_1004814101 15 Left 1004814093 6:19293886-19293908 CCCACTTTCCTCAGGTCACCCTG No data
Right 1004814101 6:19293924-19293946 AGAGAAAAGGTGGGACAATCTGG No data
1004814093_1004814099 5 Left 1004814093 6:19293886-19293908 CCCACTTTCCTCAGGTCACCCTG No data
Right 1004814099 6:19293914-19293936 TGATGAGAGAAGAGAAAAGGTGG No data
1004814093_1004814098 2 Left 1004814093 6:19293886-19293908 CCCACTTTCCTCAGGTCACCCTG No data
Right 1004814098 6:19293911-19293933 AAATGATGAGAGAAGAGAAAAGG No data
1004814093_1004814102 25 Left 1004814093 6:19293886-19293908 CCCACTTTCCTCAGGTCACCCTG No data
Right 1004814102 6:19293934-19293956 TGGGACAATCTGGTGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004814093 Original CRISPR CAGGGTGACCTGAGGAAAGT GGG (reversed) Intergenic
No off target data available for this crispr