ID: 1004817357

View in Genome Browser
Species Human (GRCh38)
Location 6:19326568-19326590
Sequence CAGAGTCACAAATTTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004817357_1004817358 -5 Left 1004817357 6:19326568-19326590 CCAGCTGTAAATTTGTGACTCTG No data
Right 1004817358 6:19326586-19326608 CTCTGAGCTTCCATAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004817357 Original CRISPR CAGAGTCACAAATTTACAGC TGG (reversed) Intergenic
No off target data available for this crispr